Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

UnrestImage

-

Let animated image disappear


CommandArgumentDatatypeDefault Min Max
Format: UnrestImage Image selectionSELECTION ---
Python: UnrestImage(selection1)
Menu:Effects > Image > Unrest
Related: AnimateImage , LoadBMP, LoadPNG , ShowImage, AutoMoveImage , HideImage, DelImage , SwapImage, MakeImageObj
Required:


If you want an animated image to rest on screen until a mouse button is pressed, choose a very long rest time (e.g. 100000), then issue a Wait command and finally use UnrestImage to continue the animation.

Example:
UnrestImage 2

Set the remaining rest on screen time of image 2 to zero. The image disappears immediately.