Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

UnlabelDis

-

Delete distances labels


CommandArgument DatatypeDefaultMinMax
Format:UnlabelDis Atom selection 1, SELECTION- - -
   Atom selection 2,SELECTION - --
  bound = Yes | NoSTRINGNo--
Python:UnlabelDis(selection1,selection2,bound=None)
Menu:Effects > Unlabel > Distance
Related:LabelDis, Unlabel , LabelPar, ShowArrow , HideArrow
Required:


The UnlabelDis command deletes distance labels between selected pairs of atoms.

The bound flag allows to unlabel only distances between bound atoms, i.e. bond lengths.

Example 1:
UnlabelDis CA,CA

Delete all Calpha-Calpha distance labels.


Example 2:
UnlabelDis all,all

Delete all distance labels.