Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Unlabel<Atom|Res|Seg|Mol|Obj|All>

-

Delete labels


CommandArgument DatatypeDefaultMinMax
Format:Unlabel<Atom|Res|Seg|Mol|Obj|All> Selection SELECTION- - -
Python: Unlabel<Atom|Res|Seg|Mol|Obj|All>(selection1)
Menu:Effects > Unlabel
Related: UnlabelDis , Label, LabelPar
Required:


The Unlabel command deletes all labels of the selected type from the selected units.

YASARA knows five different kinds of labels: scene, object, molecule, residue and atom labels, selected via the command extensions 'All', 'Obj', 'Mol', 'Seg', 'Res' and 'Atom'. Consequently, 'UnlabelAll' will delete the scene label, but not all labels in the scene - which requires the five commands 'UnlabelAll', 'UnlabelObj all' etc., most easily accessed via the shortcut Effects > Unlabel > Everything.

Example 1:
UnlabelObj 1crn

Delete the object label from 1crn.


Example 2:
UnlabelRes all

Delete all residue labels.


Example 3:
UnlabelAtom Obj 1crn

Delete all atom labels from object 1crn.


Example 4:
UnlabelAll

Delete the scene label.