Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

UndoLevels

-

Set number of undo levels


CommandArgument DatatypeDefaultMinMax
Format:UndoLevels Number = Number of editing steps to rememberINT-- -
Python:This command is mainly for internal use. It is not available in Python.
Menu:Options > Undo levels
Related: Undo , Redo
Required:


The UndoLevels command specifies how many editing steps YASARA should remember to be undone in case of unexpected results.

Setting UndoLevels to 0 significantly speeds up the handling of very large proteins.

Example 1:
UndoLevels 20

Remember the last 20 editing steps.

Example 2:
UndoLevels 0

Disable undo/redo to speed up the handling of very large proteins.