Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Undo

-

Undo changes


CommandArgument DatatypeDefaultMinMax
Format:UndoSteps = Number of steps to undo INT1 - -
Python: This command is mainly for internal use. It is not available in Python.
Menu:Edit > Undo
Keys:<Ctrl>+<U>  -  Undo the last edit step
<Ctrl>+<Z>  -  As above, to match other applications
Related:Redo, UndoLevels
Required:


The Undo command reverses the specified number of editing steps.

Undo and Redo only affect changes to the soup and the way it is visualized (i.e. commands in the menus File, Edit , View and Effects ). For other commands, Undo/Redo makes little sense (e.g. changing the window size). Molecular dynamics simulations can also not be 'undone'.

The number of Undo-levels can be changed , setting it to 0 significantly speeds up the handling of extremely large protein structures.

Commands run by a macro cannot be undone to maximize the macro speed.

Example:
Undo 3

Undo the last three edit steps.