Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

TypeAtom

-

Get the atom type


CommandArgument DatatypeDefaultMinMax
Format:TypeAtom Atom selection,SELECTION - --
  Method = ForceField | AM1BCCSTRING - --
Python:resultlist = TypeAtom(selection1,method)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:Sim, Charge
Required:


The TypeAtom command retrieves the types of the selected atoms in the context of the selected method:

  • ForceField: the atom type assigned by the current (Y)AMBER/YASARA force field (the NOVA force field does not have atom types). Normally a string with one or two characters, which are uppercase for the standard types and lowercase for the GAFF (General Amber Force Field) atom types.

  • AM1BCC: the atom type used to calculate the AM1BCC point charges, a number from 11 to 91, explained in the AM1BCC paper.

As the force field atom type is displayed in the top left HUD anyway, this command is mainly useful in the context of macros that label the atoms in a molecule with their atomtype. Note that the Label command provides a shortcut: just put 'ATOMTYPE' in the format string .

Example 1:
TypeAtom 145,ForceField

Display the type of atom 145 in the current force field.


Example 2:
typelist() = TypeAtom Res Lys 50,Method=AM1BCC

Get the atom types in residue Lys 50 with respect to the AM1BCC method and assign them to the list 'typelist'.



Example macro 1:

# EXAMPLE TypeAtom
# Requires YASARA Dynamics
Clear
# Load a scene with small molecules from the GAFF paper
LoadSce gaffexamples
# Initialize force field
ForceField Amber96
Sim Init
# Label atoms by GAFF atom type
LabelAtom all,ATOMTYPE,Height=0.4,Color=Black

Figure: Result of the example macro 1 above.



Example macro 2:

# EXAMPLE TypeAtom AM1BCC
# Requires YASARA Dynamics
Clear
# Load another scene with small molecules from the GAFF paper
LoadSce gaffexamples2
# Initialize force field
ForceField Amber96
Sim Init
# Use TypeAtom to retrieve AM1BCC atom types
# Ref. Jakalian A, Jack DB and Bayly CI (2002) J Comput Chem 23,1623-1641
typelist() = TypeAtom all,AM1BCC
for i=1 to Atoms
  LabelAtom (i),(typelist(i)),Height=0.4,Color=Black

Figure: Result of the example macro 2 above.