Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The three potential pitfalls

Our main goal was to make YASARA usable without a manual. This is only possible if the program is logically consistent. Usability tests have shown that there are three occasions where logic can seem counter-intuitive without the proper background information. These three potential pitfalls are listed below.

° 

You never get less than you want

Most commands you can choose with the mouse will show you a little pop-up menu where you can define the final selection type. Usually 'All', 'Object', 'Molecule', 'Residue ' or 'Atom'. It is important to remember that you can never get less than the type you choose. So if you click on View > Color > Residue, you will always color entire residues, no matter what you do. Even if you then pick 'Sidechain' in the list titled 'Belongs to or contains', you will not color just the side-chains, but instead all residues that contain side-chains (so no glycines).

If you want to color just the side-chains alone, note that a side-chain is less than a residue, so go to View > Color > Atom and pick 'Sidechain' in the list titled 'Belongs to or contains'. Either select the residues in the list on the left side, or type them in the manual selection field at the bottom, e.g. Res 10-20

The same principle holds when creating a color gradient: The color only changes between the units of the selected type.

  • To color all objects in an NMR bundle with a different color, go to View > Color > Object > Apply gradient
  • To color all molecules in an oligomer with a different color, go to View > Color > Molecule > Apply gradient
  • To color all residues in a molecule with a different color, go to View > Color > Residue > Apply gradient

° 

There is a difference between 'Hide', 'Switch off', 'Remove' and 'Delete'

Imagine there is a big lamp with some separate lights in your room, like the one below. Let's think of the lamp as a YASARA object, and of the lights as atoms.
Figure: A YASARA object consisting of three atoms, with one hidden atom on the right.

The lamp is switched on, you can see all the lights. Now hide the left light by putting a black (burn-proof) cap on top of it. You just cannot see it anymore, but it is still present. So if you hide atoms, they are invisible until you show them again, but they stay part of the object and you can still change their style. Changing their style e.g. from ball to stick does not make them visible.

If you now switch off the lamp, it is still at the original place, you just cannot see it in the darkness. So switching off an object will just make it invisible, but it is still fully present, its atoms are part of the soup.

Now take away the black cap to show the hidden light again - you still cannot see it, until you switch on the entire lamp. So if you show an atom in an object that is switched off, you will not see it unless you also switch on the object.

If you remove the lamp, it still exists somewhere (wherever you put it in the next room), but toggling the switch will give no result. So a removed object is not part of the soup anymore, it is stored somewhere else to be reused again later. There is no way you can do anything with a removed object, unless you bring it back.

Take a hammer and smash the entire lamp. Now its existence has been 'Deleted', it is lost forever. Your last remaining option is to turn back time (by pressing the Undo button provided by YASARA Model and above).

° 

Gaps in a molecule are bridged by default

If you load a structure determined by X-ray crystallography, there are often stretches of residues that were not visible in the electron density map, the structure has a gap. Because there is no way to distinguish between a true gap and an unintentional gap created during modeling, YASARA ignores gaps unless they are explicitly marked as true gaps. This can be helpful, as you get for example a continuous ribbon display that bridges gaps, but sometimes it is not what you want. In these cases, just delete all peptide bonds that are longer than 3 Angstroms: Go to Edit > Delete > Bond, click on atom name 'C' in the first window, 'N' in the second window and input 3 A as the minimum bond length required for deletion.

If after deleting the bonds, you save the structure as a PDB file and load it again, all bonds will reappear, because PDB files do not store information about deleted bonds. In such a case, you might consider adding a split point (an explicit chain break) at the position of the gap: Go to Edit > Split > Residue and select the residue after the gap. Split points appear as 'TER' entries in the PDB file and as vertical lines in the sequence selector at the bottom.