Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The ten magic words

Throughout this documentation, there are ten words which YASARA 'overloads' with a specific meaning.

° 

Atom

-

YASARA's representation of a true atom

Contrary to real atoms, YASARA's atoms can easily be distinguished: Every atom has a unique number and many attached properties, like chemical element, atom name, residue name, residue number, molecule name etc. Each YASARA atom maps directly to one line in a PDB file. Here is an example from 1c9b.pdb:


ATOM    105  CA  THR A 123      19.779  20.075  26.943  1.00 53.14           C

The line above describes atom 105 with name 'CA' and cartesian coordinates (19.8/20.1/27.0), belonging to residue 'Thr 123' in molecule (=chain) 'A', with an occupancy of 1.00 (fully present), a B-factor of 53.1 and finally - the chemical element is 'C'.

YASARA numbers all the atoms continuously, starting with 1. As a direct consequence, YASARA atom numbers will not always be the same as those given in the PDB file (because PDB files also number 'TER' entries, and YASARA can load many PDB files at the same time). In addition, atom numbers change frequently (for example when adding hydrogen atoms). When writing a macro, it is therefore suggested to select atoms using their name and the residue they belong to, but not using their number.

If you ever have to modify a PDB file, remember that all characters must be placed in the right column. See www.rcsb.org for a complete description of the PDB file format.

For chemical consistency, YASARA removes numbers from chemically equivalent hydrogens. More details about this mechanism can be found here.

Figure: One single carbon atom, created with the BuildAtom command.

° 

Residue

-

any continuous stretch of atoms sharing the same residue name, residue number and molecule name

Note the word 'continuous'. If you split a residue in the middle (corresponding to a TER entry in the PDB file), you will end up with two separate residues.

The scourge of molecular modeling is the 'residue numbering problem'. PDB files provide space for residue numbers up to 9999. What if there are more than 9999 residues? What if there are several residues with the same number? Most programs answer these questions by introducing a second numbering scheme, so that you have to remember two different numbers per residue. YASARA provides an easy solution: the PDB residue number is the one and only, ambiguities are resolved with the selection language and its new concept 'selection inflation':

DelRes 300
Delete residue with PDB number 300

If there is more than one residue with this number, YASARA will delete all of them. What if you want to select only one of these residues?

DelRes 300 Mol B
Delete residue with PDB number 300 in molecule (=chain) B

And finally, what if molecule B contains more than one residue with number 300? As peptide chains are generally shorter than 9999 residues, this hardly ever happens. If it does, select one of the atoms in the residue and use selection inflation :

DelRes Atom 13747
Delete the residue which contains atom 13747

Atom numbers are always unique in YASARA.

Figure: One single arginine residue, created with the BuildRes command.

° 

Molecule

-

any continuous stretch of residues sharing the same molecule name

If you already worked with other programs, you may know YASARA's 'molecules' as 'chains'. The name 'molecule' was chosen due to its more convenient abbreviation 'Mol' and for consistency with the WHAT IF program.

Note that a YASARA molecule is not always the same as a chemist's molecule. If two molecules ('A' and 'B') are joined with a disulfide bridge, they are still two separate molecules for YASARA as long as their names differ. Also if your structure contains 500 waters, all with the same molecule (=chain) name, they will be treated together as one 'molecule'.

Figure: Part of the peptide chain of crambin, created with the BuildMol command.

° 

Object

-

a collection of molecules and additional items

An object consists of molecules and other items like labels or arrows. If you load a PDB file, you will get one object. If the PDB file contains multiple models (NMR structures), every model will become one object.

Objects can be moved around independently with the mouse. Starting with YASARA Model, you can freely split objects into multiple smaller objects, and join them again.

Objects can be 'active' or 'inactive'. Inactive objects are removed from the soup , they are neither displayed on screen nor do they participate in molecular dynamics simulations. The only command that works on inactive objects is 'AddObj' - which brings them back to life.

Note that many commands act on all the atoms within an object, instead of the complete object (including labels etc.).

Example:

ColorObj 1crn,red

will color all atoms in the object named 1crn red, but not any additional items like labels or arrows that are attached to the object.


RotateObj 1crn,Y=90

will rotate object 1crn by 90 degrees about the Y-axis, including all additional items.

How can you tell the difference? Take a look at the description of the command. If you find the command listed with an 'Atom' extension (like 'ColorAtom'), you know that it is an atom-only command.

Figure: An object - Crambin with arrows, labels, hydrogen bonds and a ribbon backbone.

° 

Soup

-

all atoms in active objects

A name familiar to WHAT IF users. The soup consists of all the atoms in active objects. It does not include labels etc.

Figure: A soup of ~20000 atoms.

° 

Scene

-

all objects together

The 'Scene' includes all objects, whether active or inactive, including their position and orientation. So if you save the scene, you will also save the current view and all items like labels.

Figure: A scene with three objects (molecule A, B and Water), and some labels.

° 

All

-

the scene or the soup

Again, it depends on the type of the command whether 'all' stands for 'all objects' (the scene) or 'all atoms in active objects' (the soup), look above for an explanation.

° 

Bond

-

a covalent link between two atoms with pH dependent order

While chemistry knows many different kinds of bonds, YASARA uses the term 'bond' only for classical covalent bonds. Bonds with a high ionic character, e.g. between and to metal ions, are not treated as bonds. Instead, molecular dynamics force fields rely purely on electrostatics to reproduce these 'bonds', and adding explicit bonds would cause problems when assigning force field parameters.

If a PDB file nevertheless specifies bonds to metal ions (using the 'CONECT' record), YASARA automatically converts them to pseudo-bonds, i.e. plain cylinders that help the visualization but are not part of the soup and ignored for all other purposes with one exception: at the beginning of a simulation, they are used to add distance constraints .

A bond in YASARA has a certain order (single, double, etc.), but contrary to other molecular modeling programs, fractional bond orders somewhere between 'single' and 'double' are also supported. This helps to conserve symmetries and provides a better picture of the underlying chemistry. Bond orders can be visualized by pressing <F2> to show balls & sticks, and coloring bonds by their order .

YASARA uses the following color mapping, described in more detail here :

Name OrderColor
Single bond 1 gray
Resonance bond 1.25blue
Resonance bond 1.33magenta
Resonance bond 1.5 red
Resonance bond 1.66orange
Resonance bond 1.75bright orange
Double bond 2 yellow
Triple bond 3 green
Quadruple bond 4 cyan

Additionally, bond orders (as well as hydrogen atoms ) are assigned in a pH dependent manner. YASARA considers the influence of the pH in two ways:

  • General pH model applied to all molecules: Based on a library of SMILES strings that define protonation patterns and standard pKa values for common functional groups, YASARA assigns bond orders and adds hydrogen atoms according to the currently set default pH. This pH can be changed by clicking on Options > Default pH. If the 'Adjust bond orders and hydrogens' button is checked, YASARA will retype all bonds and reassign all hydrogens to match the new pH. The mentioned SMILES strings can be found in the GROUP_DATA section of the file yasara.def (present in YASARA Dynamics+). A simple example would be that a carboxyl group is neutral below pH 4 and negatively charged above.

  • Specific pH model applied to amino acids: When running molecular dynamics simulations of proteins, the general pH model described above is too crude. Especially active site residues often exhibit large pKa shifts depending on the environment, and instead of the general statement that 'a carboxyl group is neutral below pH 4', one would prefer the specifc conclusion that 'the pKa of residue Glu 42 is raised to 5.1, and a proton sits preferably on the OE1 oxygen'. These pKa predictions are made by the 'cell neutralization experiment', which is used to prepare a molecular dynamics simulation in YASARA Dynamics+. Since pKa predictions are non-trivial, they can be overridden with true experimentally measured pKa values before running the cell neutralization experiment.

As a conclusion, apply first the general pH model , most easily by clicking Edit > Clean > All, then fine-tune the results with the cell neutralization experiment. When this is completed, be careful to not apply the crude general model again, since it does not know about the specific tuning results.

The whole concept behind the general pH model is best illustrated with a few examples:

Figure: Bond orders and protonation patterns of small molecules as a function of pH

The figure above shows seven small molecules at pH 0 to 14.

  • Column 1 - Phenol: All carbon-carbon bonds in the aromatic 6-ring are (roughly) equivalent, the bond order is 1.5 (colored red). From pH 10 on, the hydroxyl group loses the proton.

  • Column 2 - Acetic acid: From pH 0 to 4, the carboxyl group is neutral, one oxygen makes a double bond (yellow), the other one carries a hydrogen. From pH 5 on, the proton is gone and both oxygens are equivalent, making bonds of order 1.5 (red).

  • Column 3 - Imidazole ring: From pH 0 to 6, the ring is protonated, both nitrogens carry a hydrogen and make equivalent bonds of order 1.5 to the carbon in between. The nitrogen valence is thus 3.5, corresponding to a formal charge of +0.5 per nitrogen and +1 in total. From pH 7 on the symmetry is broken, the molecule is neutral, and the nitrogen that does not carry a hydrogen makes a double bond instead.

  • Column 4 - Sulfurous acid: Below pH 2, the molecule is neutral, two oxygens make double bonds, the other two carry hydrogens. From pH 2 to 6, one hydrogen is gone, three oxygens are equivalent due to resonance effects, making bonds of order 1.66 (orange) each. The valence of the sulfur atom stays at 6 (1+3*1.66), and each of the three equivalent oxygens gets a formal charge of -0.33, summing up to -1. From pH 7 on, both hydrogens dissociate, all four oxygens make equivalent bonds of order 1.5 (red). The four resulting formal charges of -0.5 sum up to -2.

  • Column 5 - Guanidinium group: The side-chain of the amino acid arginine is a strong base due to resonance effects. From pH 0 to 12, the group is protonated, each nitrogen makes a bond of order 1.33 (magenta) to the central carbon. The carbon valence is thus normal (4), while each nitrogen has a valence of 3.33, the three resulting formal charges of +0.33 sum up to +1 in total. From pH 13 on, the symmetry is broken, one nitrogen loses a proton and makes a double bond.

  • Column 6 - Carbonic acid: Below pH 7, the molecule is neutral, one oxygen makes a double bond, the other two carry hydrogens. From pH 7 to 10, one hydrogen is gone, two oxygens are equivalent and make bonds of order 1.5 (red). From pH 11 on, both hydrogens dissociate, all three bonds are equivalent with order 1.33 (magenta). The three formal charges on the oxygens (-0.66) sum up to -2.

  • Column 7 - Phosphoric acid: Similar to carbonic acid, just the phosphorus has a valence of 5 and therefore carries an additional hydrogen atom.

° 

Local coordinate system - The coordinate system within one object

Because objects can be moved around and rotated independently, every object has its own local coordinate system. The cartesian atom coordinates specified in the PDB file are the same as those in the local coordinate system. (Coordinates shift if you center the object, and the sign of the X-coordinate flips if YASARA uses a left-handed coordinate system).

Sometimes it is desirable to let several objects share the same local coordinate system. There are several ways to achieve that:

  • Load the objects right after each other with the 'Center' option disabled, and don't move the first away before loading the second.
  • Transfer one object to the coordinate system of the other object.
  • Superpose the objects.
  • Join the objects.
  • Transform the coordinate system of all objects, then Center them all together.
  • Start a Simulation to transfer all objects into the coordinate system of the simulation cell.

° 

Global coordinate system - The coordinate system of the scene

All objects are positioned and oriented with respect to YASARA's global coordinate system. Only these global coordinates change if you move or rotate an object. Unless you grab a single object, all objects rotate together around their common geometric center (or around the center of the simulation cell if one has been defined).

Figure: YASARA's left-handed coordinate system. The X-axis (red) points to the right, the Y-axis (green) points up and the Z-axis (blue) points into the screen. You can use the first three fingers of your left hand to mimic these arrows.

Figure: YASARA's right-handed coordinate system . The X-axis (red) points to the left, the Y-axis (green) points up and the Z-axis (blue) points into the screen. You can use the first three fingers of your right hand to mimic these arrows.