Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The slow method: explicit solvent molecular dynamics simulation with the YAMBER force field

This method is described in the article Making optimal use of empirical energy functions: force field parameterization in crystal space Proteins 57,678-683:

  • Create a project directory 'MyDir'.

  • Store a PDB file of your model there (MyStructure.pdb).

  • Click Options > Macro & Movie > Set target and choose MyDir/MyStructure.pdb as the target.

  • Click Options > Macro & Movie > Play and choose md_refine.mcr.

  • Wait until the 500 ps simulation is finished.

As described in the publication cited above, this method does not work for all models, there are some which move in the wrong direction. These cases can be detected by looking at the structural quality (force field energy, Ramachandran plot, packing). YASARA will therefore analyze the snapshots at the end and save the results as a table, so that the lowest energy structure can be easily identified. If you have the Twinset installed, this table will also contain the above mentioned WHAT IF quality indicators.