Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Your guide to YASARA View



° 

Essentials

-

What you really have to know


° 

Selections

-

Tell YASARA what you want


° 

Commands

-

Tell YASARA what to do


° 

Recipes

-

Answer complex questions


° 

Macros

-

Automate your work with Yanaconda


° 

Plugins

-

Extend YASARA with your own functions


° 

Scripts

-

Use YASARA as a Python module


° 

Troubleshooting

-

Get things going


° 

Known inconveniences

° 

YASARA cannot be installed


° 

The message './install_yasara: No such file or directory' appears in the Linux terminal

° 

YASARA does not start


° 

YASARA does not start from CD

° 

You are using Windows and nothing happens when you start YASARA

° 

A message about /dev/nvidiactl permission problems appears in the Linux terminal

° 

'Killed' or 'Segmentation fault' appears in the Linux terminal

° 

'Error while loading shared libraries' appears in the Linux terminal

° 

A red box appears: Error 2 - Essential videomode not supported under Linux

° 

A red box appears: Error 53 or 353 - No vector registers available or wrong CPU architecture

° 

A red box appears: Error 93 - Center of YASARA window off screen

° 

The YASARA windows stays empty and black in Linux

° 

YASARA displays an error-like message in the terminal


° 

The message '*** Assertion failure in -[NSEvent deviceDeltaX]' appears in the terminal

° 

The message 'Disabled smooth atom colors' appears in the terminal

° 

The message 'disabling TCL support' appears in the terminal

° 

The message 'libgcc_s.so.1 must be installed for pthread_cancel to work' appears in the terminal

° 

The message 'libGL warning: 3D driver claims to not support visual 0x4b' appears in the terminal

° 

The message 'Mesa X.Y.Z implementation error' appears in the terminal

° 

The message 'XFree86-DRI missing' appears in the terminal

° 

YASARA gets stuck in the startup screen

° 

YASARA displays a warning at the bottom of the startup screen


° 

Warning

-

Python not found

° 

Warning

-

Screen update not synchronized

° 

YASARA crashes right after the startup screen

° 

Something is wrong with the user interface


° 

YASARA crashes completely when you activate a menu

° 

It takes too long till the menu appears

° 

When the menu appears, the colors turn crazy

° 

Some menu entries are missing

° 

The mouse pointer disappears or flickers

° 

Some keys do not work as expected

° 

The Spaceball 3D controller does not work as expected

° 

YASARA runs slowly or displays incorrect graphics


° 

You have an unknown graphics cards, it is relatively old or has less than 16MB video memory

° 

You are running Windows Vista

° 

You are running Windows with an nVIDIA card

° 

You are running Windows with an ATI Radeon card

° 

You are running Linux with an nVIDIA card

° 

You are running Linux with an ATI Radeon card

° 

You are running Linux with a Xig graphics driver

° 

You are using a notebook

° 

You have an Intel 82845G graphics chip

° 

You have an Intel 82865G graphics chip

° 

You have an Intel 82915G graphics chip

° 

You have an S3 graphics chip

° 

You have a SiS M650 graphics chip

° 

You have a 3DLabs Wildcat card

° 

YASARA shows strange CPU usage patterns or crashes on dual core CPUs or dual CPU systems

° 

Something is wrong with your molecule


° 

You used OpenBabel ('other Fileformat') to read/write the molecule

° 

YASARA does not behave as expected with two or more connected monitors

° 

Quad-buffered stereo cannot be activated or flickers.

° 

YASARA fails to run Python plugins or other programs like PovRay, OpenBabel, MSMS

° 

YASARA or the entire computer freezes


° 

YASARA hangs, but other programs are not affected

° 

The computer freezes when you minimize the YASARA window

° 

The computer freezes when you start YASARA a second time

° 

YASARA quits with a red error box or crashes sometime later

° 

The Twinset encounters a technical problem

° 

Forwarding the YASARA window via SSH does not work