Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Troubleshooting

-

Get things going

This section contains hints how to solve problems that are beyond our 'access rights', so that we cannot fix the root of the problem. There are also some YASARA features that may look like bugs listed below.

Important: When YASARA exits with a fatal error, a red notification box is displayed, which also allows you to save your work. You can then find two files in your working directory: 1) errorexit.sce is a YASARA scene which you can load to restore whatever you had on screen, and 2) yasara.err contains a description of the problem, which helps us to identify the source of the trouble.

° 

Known inconveniences

There are a handful of 'features' that look like bugs, but cannot be fixed without a severe impact on performance or other important factors:

  • If you resize the YASARA window, it may jump to a different location. This behavior is required by YASARA's graphics engine. If you are using two monitors, look here for more details.

  • If you put a window that is always on top (e.g. the Windows task manager) in front of the YASARA window, activate a YASARA menu entry, and move the other window away, a copy of this window may remain visible until you leave the YASARA menus. It depends on your OpenGL driver whether or not this behavior can be observed.

  • If your keyboard contains special characters (German 'Umlaute', French characters with accents etc.), these keys will not work. The main reason is that using these characters would render your macros or movies unusable for people with a different operating system, creating a chain of troubles, which we decided to break in the beginning. Also YASARA's vector fonts usually do not contain these characters, so they could not be displayed anyway.

  • When using semi-transparent surfaces combined with YASARA's built in antialiasing, there may be thin borders around some atoms. This is normal OpenGL behavior. The only workaround is to disable YASARA's antialiasing and activate OpenGL hardware antialiasing in the settings of your video card.

° 

YASARA cannot be installed

° 

The message './install_yasara: No such file or directory' appears in the Linux terminal

This problem was observed in (K)Ubuntu AMD64 and is caused by their aim to squeeze the entire system on a single CD, at the cost of dropping backwards compatibility. You need to install the missing packages with this command:

sudo aptitude install ia32-libs

If this fails, for example because you do not have a direct internet connection, then surf to packages.ubuntu.com, scroll down to 'Search' and download the following packages manually:

libc6-i386
lib32gcc1
lib32stdc++6
lib32z1
ia32-libs

For each of these packages, type

sudo dpkg install NameOfThePackageWithAllExtensions

° 

YASARA does not start

° 

YASARA does not start from CD

This can happen under Linux, when you mounted the CD with the wrong flags. You then get a 'Permission denied' error message. To solve the problem, open the file /etc/fstab and search for a line like the following:


/dev/cdrom   /mnt/cdrom       iso9660 ro,user,exec,noatime    0  0

Now make sure that you have the exec and noatime flags set, then remount the CD.

° 

You are using Windows and nothing happens when you start YASARA

The most likely reason is that you do not have enough memory: Your computer needs to have a total of 128 MB physical memory installed for the normal YASARA and 512 MB for the Twinset YASARA, as well as twice this amount of swap space (256 MB for YASARA and 1 GB for the Twinset).

Another rare cause for this problem was reported by users who had anti-virus software like TrendMicro2005 activated with maximum security settings. These programs may silently prevent you from running any software that has been downloaded from the web. Temporarily deactivate the tool, then run YASARA again.

° 

A message about /dev/nvidiactl permission problems appears in the Linux terminal

If YASARA does not start, but a message like


Error: Could not open /dev/nvidiactl because the permissions
       are too restrictive.  Please see the FREQUENTLY ASKED QUESTIONS
       section of /usr/share/doc/NVIDIA_GLX-1.0/README for steps
       to correct.

appears, become root and run the following commands:

chmod 0666 /dev/nvidia*
chown root /dev/nvidia*

To prevent the problem from reappearing, it may help to reconfigure the security module of the PAM system. In most cases this security system works, but it can get confused. Different Linux distributions have different files to control this; please consult with your distributor for the correct method of disabling this security feature. As an example, if your system has the file /etc/security/console.perms then you should edit the file and remove the line that starts with 'dri' (we have also received reports that additional references to dri in console.perms must be removed). If instead your system has the file /etc/logindevperms then you should edit the file and remove the line that lists /dev/nvidiactl. The above steps will prevent the PAM security system from modifying the permissions on the NVIDIA device files.

° 

'Killed' or 'Segmentation fault' appears in the Linux terminal

This message indicates that the operating system decided to kill YASARA instead of running it. The most likely reason is that you do not have enough RAM to run YASARA without exhausting your swap space and freezing your system. Your computer needs to have 128 MB physical memory installed for the normal YASARA and 512 MB for the Twinset YASARA, as well as twice this amount of swap space (256 MB for YASARA and 1 GB for the Twinset).

To check your configuration, open a terminal and type

free

The output should look roughly like this one:

             total       used       free     shared    buffers     cached
Mem:        255240(a)  239944      15296          0      11332     112944
-/+ buffers/cache:     115668     139572
Swap:       522072(b)     252     521820

To run YASARA, the number marked (a) should be >120000, while (b) should be >250000. For the Twinset, (a) should be >500000 and (b) should be >1000000.

If you meet these requirements and still get killed, edit the file yasara.ini and change the 'Memory' field like that:

Memory 48

If that works, you can subsequently assign larger amounts of memory to YASARA.

If it still does not work, type


ulimit -a

and check that all memory options are set to 'unlimited':

max locked memory     (kbytes, -l) unlimited
max memory size       (kbytes, -m) unlimited
virtual memory        (kbytes, -v) unlimited

If this is not the case, set them to unlimited:

ulimit -l unlimited
ulimit -m unlimited
ulimit -v unlimited

Some of this changes may only be made by user 'root'. To make them permanent, you have to edit the file /etc/security/limits.conf and add the lines

* hard memlock unlimited
* soft memlock unlimited
* hard rss unlimited
* soft rss unlimited
* hard data unlimited
* soft data unlimited

And afterwards reboot the machine.

° 

'Error while loading shared libraries' appears in the Linux terminal

To make the YASARA executable small, it is dynamically linked to a number of libraries that are normally installed in every Linux distribution since 2000. If you encounter the problem, please contact support@yasara.org and provide details about your Linux distribution, as well as the output of this command:


ldd ./yasara

We will then quickly send you a new download link that solves the problem.

Alternatively, you can install the missing library yourself, assuming that you know the root password on your machine or your system administrator allows 'sudo' access to package installation.

A special case are 64bit Linux distributions (AMD64): especially (K)Ubuntu normally comes without backwards compatible support for 32bit applications, look here for a solution .

° 

A red box appears: Error 2 - Essential videomode not supported under Linux

One possible explanation is that YASARA tried to enter fullscreen mode using an extremely high resolution screen (or two screens combined with TwinView etc.). In this case just delete the file yasara/yasara.ini and restart.

If this does not help, open a terminal, type glxinfo and check the output for available visuals. It should look a bit like that:


   visual  x  bf lv rg d st colorbuffer ax dp st accumbuffer  ms  cav
 id dep cl sp sz l  ci b ro  r  g  b  a bf th cl  r  g  b  a ns b eat
----------------------------------------------------------------------
0x21 16 tc  0 16  0 r  y  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x22 16 dc  0 16  0 r  y  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x23 16 tc  0 16  0 r  .  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x24 16 tc  0 16  0 r  y  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None
0x25 16 tc  0 16  0 r  .  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None
0x26 16 dc  0 16  0 r  .  .  5  6  5  0  0 16  0 16 16 16 16  0 0 None
0x27 16 dc  0 16  0 r  y  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None
0x28 16 dc  0 16  0 r  .  .  5  6  5  0  0  0  0 16 16 16 16  0 0 None

If you get nothing comparable, you need to install OpenGL drivers for your video card. Contact your system administrator if you do not have the root password, otherwise visit www.nvidia.com or www.ati.com for more details.

° 

A red box appears: Error 53 or 353 - No vector registers available or wrong CPU architecture

There are two reasons for this error message:

  • When downloading YASARA, you selected a different CPU than the one in your computer. Go to www.yasara.org/update, input the serial number that is listed in our mail with the initial download link, and choose 'Many different, I want to install on multiple PCs' as your CPU.

  • When downloading YASARA, you did not select a specific CPU. In this case, the processor in your PC is either many many years too old for molecular modeling (Pentium MMX, Pentium II, AMD K6 etc.) or a rather exotic model that is incompatible with the current mainstream CPUs. You can unfortunately not run YASARA on this PC.

° 

A red box appears: Error 93 - Center of YASARA window off screen

  • If you have been able to start YASARA in the past, then the reason for this error is most likely the one described in the error box. Restart YASARA, and if this does not help, delete the file yasara.ini to set the window size back to the default.

  • If this is the first time you try to run YASARA, then the reason for this error is almost certainly a bug or incomplete functionality in your OpenGL graphics driver. The following hardware configurations have been reported to occasionally cause this problem:

  • Linux with some ATI Radeon cards and a Tungsten Graphics/Mesa DRI OpenGL driver. Type
    glxinfo
    
    and check if the output contains the following lines:
    
    OpenGL vendor string: Tungsten Graphics, Inc.
    OpenGL renderer string: Mesa DRI Radeon 20020611 AGP 1x x86/MMX/SSE NO-TCL
    OpenGL version string: 1.2 Mesa 4.0.4
    
    
    If this is indeed the case, click here for instructions how to install the high-performance ATI Radeon graphics driver.

  • Windows with some exotic, not entirely OpenGL compliant integrated graphics chipsets like the SiS Mirage 2 (SiS760GX chipset, version 3.75). Please notify us if a newer driver version solves the problem.

° 

The YASARA windows stays empty and black in Linux

This problem was observed in Fedora Core 6 as soon as 3D desktop effects were activated. Updating the X-server to the latest version (1.1.1-47.7.fc6) solved the issue.

° 

YASARA displays an error-like message in the terminal

° 

The message '*** Assertion failure in -[NSEvent deviceDeltaX]' appears in the terminal

This warning appears when you switch between the MacBook TrackPad and an external mouse with scroll wheel. The message is caused by a chain of design bugs in MacOSX, and can safely be ignored.

° 

The message 'Disabled smooth atom colors' appears in the terminal

When you start YASARA under Linux and get the message
Disabled smooth atom colors because OpenGL extension XY is not supported
then your OpenGL driver is either very old or not installed properly. YASARA still runs, but it can display only the following atom colors: blue, magenta, red, yellow, green, cyan and gray, e.g. smooth color gradients will only be visible in ribbons and ray-traced output, but not in the individual atoms on screen.

This problem sometimes comes together with an error message about extension "XFree86-DRI" missing on display ":0.0" .

° 

The message 'disabling TCL support' appears in the terminal

If the message 'Loading required GL library /usr/X11R6/lib/libGL.so.1.2 disabling TCL support' appears in the terminal, this indicates that your OpenGL driver is not installed properly. This was reported for the default installation of some ATI Radeon cards, and YASARA may subsequently hang in the startup screen. Click here for instructions how to install proper Radeon drivers .

° 

The message 'libgcc_s.so.1 must be installed for pthread_cancel to work' appears in the terminal

This warning may appear on some Redhat Linux distributions and is normally harmless. To get rid of the message, install the compat-glibc RPM, for example compat-glibc-7.x-2.2.4.32.6.i386.rpm.

In another case where this error message was not harmless but prevented YASARA from running, it turned out that the reason was third party software that changed environment variables to replace system libraries. Removing these changes solved the problem.

° 

The message 'libGL warning: 3D driver claims to not support visual 0x4b' appears in the terminal

This warning is not related to YASARA and affects all OpenGL applications. Rumours are that it is caused by a Linux kernel problem, occurs in all distributions with certain video chips (e.g. Intel) and will be resolved in kernel 2.6.20. Fortunately YASARA runs correctly, the message can thus be ignored.

° 

The message 'Mesa X.Y.Z implementation error' appears in the terminal

This bug was observed with Radeon 9600 cards in Linux, it has been reported to freedesktop.org Click View > Lighting and set 'Ambient influence' and 'Shadow density' to 0 as a workaround.

° 

The message 'XFree86-DRI missing' appears in the terminal

When you start YASARA under Linux and get the message
Xlib: extension "XFree86-DRI" missing on display ":0.0"
this indicates that your OpenGL driver is not installed properly. This happens for example when installing an old nVIDIA driver on a new Linux distribution with Kernel 2.6, e.g. Fedora Core 1. Do not ignore the message, you may encounter serious graphics problems and system hangs. Instead update to the latest driver.

If you absolutely have to use an old driver (for example because of stereo support), you can still modify the old nVIDIA driver to work with a new kernel: http://www.minion.de/nvidia.html and http://sh.nu/download/nvidia/linux-2.6/

° 

YASARA gets stuck in the startup screen

If YASARA displays the startup screen with the message 'Initializing graphics engine...' at the bottom, but nothing else happens, this can have a number of reasons:

  • Your OpenGL driver may have a serious performance problem. This is the case with Matrox G400-G550 cards, that need three minutes to get past the startup screen. Go for a cup of coffee, this happens only the first time and when you try to resize the window. Anyway, the three spare minutes are probably a good time to get a new graphics card.

  • While the startup screen is displayed, YASARA runs extensive OpenGL calibration algorithms, which may cause broken OpenGL drivers to hang. Most of the time, this happens in Linux and indicates that you need to install a new OpenGL driver. Click here for more details.

° 

YASARA displays a warning at the bottom of the startup screen

All these warnings are non-fatal, YASARA will run normally. If it does not, the reason lies somewhere else.

° 

Warning

-

Python not found

YASARA plugins use the Python scripting language. If Python is not installed, these plugins will not be loaded and some convenient options will be missing in the menus (e.g. to get PDB files from the web). Just click Help > Install program > Python to install it, or alternatively download Python from www.python.org . You need to restart YASARA afterwards.

An alterative explanation is that your computer is running short of swap space and YASARA cannot run Python. Look here for more details.

° 

Warning

-

Screen update not synchronized

In order to display graphics smoothly, YASARA should redraw the screen synchronously with your monitor, otherwise you may encounter so called 'tearing effects'. Not all graphics cards allow you to activate this option.

In Windows try to go to Control Panel > Display > Settings > Advanced > OpenGL and see if there (or close by) is an option called 'Activate Sync to VBlank'.

In Linux, it depends on your graphics card. nVIDIA cards should be handled automatically by YASARA. Until 2006, ATI Radeon drivers allowed you to activate this option during the installation. Nowadays you can simply run as root 'aticonfig --sync-vsync=on' and then restart the X-server. Unfortunately this does not always work.

In MacOSX, YASARA normally activates the synchronization automatically. If you nevertheless get the warning, it points towards an internal MacOSX problem.

° 

YASARA crashes right after the startup screen

This problem was reported for some S3 graphics chips and is caused by a bug in their driver. Updating the S3 graphics driver (www.s3graphics.com) to at least version 139412 solves the issue. If you do not know which graphics chip you have, look here.

° 

Something is wrong with the user interface

When you click on an entry in the top menu line or bring up a context menu, some things can go wrong.

° 

YASARA crashes completely when you activate a menu

This behaviour was confirmed for two graphics chips:

  • NVIDIA Riva TNT2 with very old, broken OpenGL drivers (e.g. version .1200). Download the latest drivers from www.nvidia.com to solve this problem. Version .5216 was confirmed to work perfectly.

  • S3 Twister chips that are sometimes found in notebooks: Crashes were observed with rather old, broken OpenGL drivers. Get the latest one and notify us if this solves the problem.

° 

It takes too long till the menu appears

A trivial first solution is to disable window animations: click on Window > Animation > Off.

Then make sure that you have hardware accelerated OpenGL support installed .

If you are using old drivers for ATI Radeon and Matrox G400-G550 cards, it may take half a second for the menu to appear. Owners of a Radeon 8500 card and above can simply update the driver, this will solve the problem. For cards older than the Radeon 8500, this may help as well, please report your experience. For Matrox owners, updating the driver can even make things worse, and it's probably best to just get a new graphics card.

° 

When the menu appears, the colors turn crazy

This only happens with Radeon 8500 cards and is a bug in ATI's driver. The problem has been reported, and solved by ATI in the Catalyst driver 3.4 and later. As a work-around, you can also go to Control panel > Display > Settings and set the screen color depth to '32 bit true color'. You can also try to edit yasara.ini and set VisualQual to 0.

° 

Some menu entries are missing

YASARA uses plugins written in Python, that add their own menu entries. If Python is not installed or broken, these menu entries will not appear. Look here for more details .

° 

The mouse pointer disappears or flickers

This can happen if you installed a 'fancy mouse pointer'-tool, that shows very colorful pointers. If these pointers cannot be displayed as a hardware cursor by your graphics card, the operating system has to copy the mouse pointer pixel by pixel into the video ram, which often does not work with OpenGL windows. Switch back to a simple mouse pointer to solve this issue. (Under Linux, that's often an option in /etc/X11/XF86Config or /etc/X11/xorg.conf, e.g. for NVIDIA cards, you must set hwcursor to "1").

° 

Some keys do not work as expected

The usual reason is that another application has registered certain keyboard-shortcuts as hot-keys, which then do not reach YASARA anymore. Exit YASARA and press the problematic key or combination of keys to see what happens and find the application in charge. Then change the hot-key settings there.

° 

The Spaceball 3D controller does not work as expected

The Spaceball from 3DConnexion is currently only supported in Linux. YASARA has been tested with the Spaceball 3003FLX, but also the later models should be compatible.

Before you start YASARA, make sure that the Spaceball driver is running:

ps -ef | grep xdriver

If you do not see output except one line with grep, start the xdriver manually (you can find the program on the Spaceball CD in the unix/linux directory).

./xdriver -new

Click 'Automatic search' to locate the Spaceball. If it cannot be found, follow the hints displayed and also run the xdriver program as root.

As soon as the Spaceball has been detected, choose the Application 'X Window Driver 2.0/3.0' and click 'Install', then 'Exit'.

Now you can start YASARA and configure your Spaceball by clicking on Window > Spaceball. More details can be found at the SpaceballPar and SpaceballButton commands.

° 

YASARA runs slowly or displays incorrect graphics

If YASARA responds very slowly, this can have a couple of different reasons. A trivial cause may be that your 'FramesPerSecond' setting is too low: Click Window > Update frequency and set it to a high number, e.g. 75.

° 

You have an unknown graphics cards, it is relatively old or has less than 16MB video memory

If you are running Windows 95 to XP, click on Start > Control Panel > Display > Settings > Advanced > maybe 'Adapter' or 'Options', depends on your card. In Windows NT, the usual location is Start > Settings > Control Panel > Display > Settings > Display type. Somewhere around there, you should find the name of your graphics card and the driver version (e.g. a list of *.dll files).

In Windows Vista, click Start > Control panel > Classic View > Device Manager > Display adapters. Double-click on your display adapter, then click 'Driver'.

In Linux, open a terminal and type
glxinfo
to display information about your OpenGL driver.

If you purchased your graphics card before 2000, it may be a problem to run YASARA at a usable speed. The reason is usually not that the graphics card is too weak, but that there is not enough video memory and the driver switches back to software rendering. Nevertheless, YASARA runs OK on a Matrox G400 with 16MB ram. First edit the file yasara.ini and set VisualQual to 0, then reduce your screen color depth to 16 bits (65536 colors), and the screen resolution to <=1024x768. If this helps, try subsequently higher resolutions. If you have less than 16MB ram on your video card, it's probably best to just get a new one.

Examples of cards that are just too old for YASARA:
  • ATI Mach, Rage IIC, Rage XL, Rage XC
  • All 3DFX Voodoo cards
  • Matrox Mystique

° 

You are running Windows Vista

Microsoft unfortunately ships graphics drivers with reduced functionality, which support only very slow OpenGL software rendering and leave the power of your graphics card unused, except for the transparent Aero glass windows and video games.

Click Start > Control panel > Classic View > Device Manager > Display adapters to determine the manufacturer of your graphics chip. Double-click on your display adapter, then click 'Driver' to find your graphics driver version.

Known issues:

  • nVIDIA drivers 7.14.10.9677 and older are known not to accelerate graphics, downloading the latest Windows Vista driver from www.nvidia.com solves the problem. The new driver version should be 9.6.8.5 or higher.

  • Windows Vista is currently (2006/12/01) not well suited for running graphics intensive scientific applications like YASARA. Even with the latest nVIDIA drivers, the performance is only ~30% of what you get in Linux or Windows XP on the same machine. Try to avoid Windows Vista until Microsoft has solved the technical problems.

° 

You are running Windows with an nVIDIA card

In this case it is most likely a driver issue . During the development of YASARA, we found lots of bugs in OpenGL graphics drivers, which we reported to the respective companies (e.g. ATI, nVIDIA, Matrox). These bugs were fixed in subsequent driver releases, so most of the time you can solve the issue by just installing the latest drivers.

To determine your OpenGL driver version, click on Start > Control Panel > Display > Settings > Advanced > Adapter. You will somewhere find a list of files with version numbers like..

nvopengl.dll 4.13.01.3082

In this nVIDIA example, 3082 is the driver version.

  • The original Microsoft drivers shipping with Windows XP are bugged and can cause YASARA to crash. Please download the latest driver from www.nvidia.com.

  • nVIDIA Geforce driver versions 3082 and earlier cannot run YASARA properly, installing new drivers (at least version 4523) solves the problem.

  • nVIDIA Quadro drivers around version 6693 have a bug that makes the YASARA console at the bottom of the window invisible. Updating to at least version 7184 solves the problem.

° 

You are running Windows with an ATI Radeon card

In this case it is most likely a driver issue. During the development of YASARA, we found lots of bugs in OpenGL graphics drivers, which we reported to the respective companies (e.g. ATI, nVIDIA, Matrox). These bugs were fixed in subsequent driver releases, so most of the time you can solve the issue by just installing the latest drivers.

To determine your OpenGL driver version, click on Start > Control Panel > Display > Settings > Advanced > Adapter. You will somewhere find a list of files with version numbers.

  • ATI driver version 6.14.10.6542 from 2005 was reported to show completely corrupted graphics on a dual core machine with an ATI Radeon X600 PRO card. Updating the Radeon driver to Catalyst 6.6 solved the problem.

  • ATI Catalyst 6.11 from 2006 with OpenGL driver 6.14.10.5819 was reported to show colorless ribbons and cartoons or even crash on an ATI Radeon 7000 card with 32MB video ram and two connected monitors. Closer inspection showed that the driver couldn't cope with the exhausted video ram. The problem could be solved by not expanding the desktop over both monitors.

° 

You are running Linux with an nVIDIA card

nVIDIA does not allow Linux distributors to include their Geforce drivers. So a freshly installed Linux will run terribly slow with OpenGL applications, including YASARA. (Non-OpenGL programs like Rasmol will work fine however, that's why you may not have noticed it.)

Open a terminal and type

glxinfo | grep vendor

If the output does not show 'nVIDIA corporation' but 'SGI' and 'www.mesa3d.org', you DO NOT have an accelerated OpenGL installation and cannot use the power of your Geforce card.

To best way to install the required drivers depends on your Linux distribution. It is likely that your distribution offers prebuilt packages, which you can simply install with your package manager.

For (K)Ubuntu, the usual sequence of commands (after enabling the universe and multiverse repositories) is:

sudo apt-get update
sudo apt-get install nvidia-glx
sudo dpkg-reconfigure xserver.org (select 'nvidia' from the list)

Edit the file /etc/X11/xorg.conf, and follow the instructions below regarding dri and nvidia. The press <Ctrl>+<Alt>+<Backspace> to restart the X-server. If 'glxinfo | grep vendor' now displays nVIDIA, you are ready to go.

Fedora Core 5 is broken with respect to the official nVIDIA drivers. A solution is provided at http://www.fedorafaq.org/#nvidia. Even with this recipe, we got one or two reports of unexpected nVIDIA problems on Fedora Core 5.

If there are no prebuilt packages for your distribution , go to www.nvidia.com and download their latest Linux driver. They also provide detailed installation instructions. Note that you need the root password to install.

The probably most important thing when installing is that your X-server is not running. Press <Ctrl>+<Alt>+<F2> to switch to a text screen, log in as root and type
/sbin/init 3

Usually you type
sh ./NVIDIA-Linux-x86-1.0-[DriverVersion].run
to install (for SuSE Linux, add the parameter -q).

If this fails, you have to look in the file /var/log/nvidia-installer.log

After installing, you can find detailed instructions on how to proceed in the file
/usr/share/doc/NVIDIA_GLX-1.0/README

It is especially important to adapt the file /etc/X11/XF86Config or /etc/X11/xorg.conf:

  • In the 'Device' section, replace the line
    Driver "nv"
    
    with
    Driver "nvidia"
    

  • In the 'Module' section, delete the lines
    Load "dri"
    
    and (if present)
    Load "GLcore"
    
    and make sure you have
    Load "glx"
    

Now type
init 5
to restart X.

If completed successfully, 'glxinfo' should show 'NVIDIA Corporation' as OpenGL vendor. You can now restart YASARA.

Additional hints:

  • SuSE distributes some 'special editions' of e.g. SuSE 9.0 on one CD. You often find these bundled with computer magazines. Before you can install the nVIDIA drivers on such a special edition, you need to download the following RPMs from the SuSE FTP server:
    
    kernel-source
    glibc-devel
    make
    gcc
    
    

  • SuSE Linux requires to run sax2 after installing the nVIDIA drivers:


sax2 -r -m 0=nvidia (0 is a digit, not a letter!)

  • The Linux Compiz window manager for advanced desktop 3D effects was once reported to make the sticks between atoms disappear as soon as a non-standard atom colors are chosen.

  • On a Fedore Core 1 installation, you may get a complaint about a "Failed cc sanity check", which should be taken seriously. Do not follow the possibility to set the 'IGNORE_CC_MISMATCH' flag, this causes serious graphics problems and can freeze your system. Instead download the latest nVIDIA driver to solve this issue.

° 

You are running Linux with an ATI Radeon card

When running OpenGL applications in Linux, you should buy a graphics card from nVIDIA, since they provide the best graphics drivers that cause the least number of problems. ATI Linux drivers tend to expose graphics bugs, are often impossible to install or do not support the latest chips. This has gotten better lately with the takeover by AMD.

If your computer already contains an ATI Radeon card, there is a resonable chance that everything works correctly if you follow these hints:

NOTE: If you successfully installed the Radeon drivers and YASARA's user interface still lags behind, scroll to the end of this section.

Most default Linux installations (e.g. RedHat, Fedora) do not activate hardware accelerated OpenGL graphics for newer Radeon cards. Instead, only the unusably slow Mesa software emulation is available.

Open a terminal and type

glxinfo

If the output indicates that your OpenGL vendor is 'Tungsten Graphics', then there is a good chance that YASARA works correctly, especially on older Radeon chips (on Radeon 9600, you may get a 'Mesa implementation error' however, which can be worked around by disabling shadow and lighting at View > Lighting):


OpenGL vendor string: Tungsten Graphics, Inc.
OpenGL renderer string: Mesa DRI Radeon 20020611 AGP 1x x86/MMX/SSE NO-TCL
OpenGL version string: 1.2 Mesa 4.0.4

On the other hand, if you find the following in the output, you do not have hardware accelerated 3D graphics activated, and using YASARA with this configuration is hopeless:


OpenGL vendor string: Mesa project: www.mesa3d.org
OpenGL renderer string: Mesa GLX Indirect
OpenGL version string: 1.3 Mesa 4.0.4

In latter case, you need to install the proper driver from ATI: click on www.ati.com and download the latest Linux Radeon driver.

Installation instructions for Fedora Core

At least in Fedora Core 5 and 6, the drivers available from the ATI web site cannot be installed. The Fedora project however provides customized drivers as RPM packages in the livna repository:

  • Become root
  • Add the Livna repository to yum:
    rpm -Uhv http://rpm.livna.org/livna-release-6.rpm
    
  • Install the ATI kernel module and OpenGL driver (you can leave out *-32bit on 32bit systems)
    
    yum install kmod-fglrx xorg-x11-drv-fglrx xorg-x11-drv-fglrx-libs-32bit
    yum update kmod-fglrx xorg-x11-drv-fglrx xorg-x11-drv-fglrx-libs-32bit
    
    
  • Configure the driver:
    
    service ati-fglrx restart
    ati-fglrx-config-display enable
    
    
  • If you did not disable SELinux during installation:
    
    setsebool -P allow_execstack=1
    setsebool -P allow_execmod=1
    
    
  • Make sure that the file /etc/X11/xorg.conf contains the following sections:


Section "Module"
  Load "dbe"
  Load "extmod"
  Load "fbdevhw"
  Load "glx"
  Load "record"
  Load "freetype"
  Load "type1"
  Load "dri"
EndSection

Section "Device"
  Identifier  "aticonfig-Device[0]"
  Driver      "fglrx"
  Option      "VideoOverlay" "on"
  # This enables VSYNC
  Option      "Capabilities" "0x00000800"
EndSection

Section "ServerFlags"
  Option "AIGLX" "False"
EndSection

Section "DRI"
  Group 0
  Mode 0666
EndSection

Section "Extensions"
  Option "Composite" "False"
EndSection

  • Restart the X-server.
  • Open a terminal and verify that 'glxinfo' displays:
    
    ...
    OpenGL vendor string: ATI Technologies Inc.
    ...
    
    

Installation instructions for other Linux distributions and the new *.run drivers (2005 and later)

In 2005, ATI introduced a new installer (usually a big file >50 MB) with the extension '.run'.

  • Check that you have the GCC compiler as well as the Linux kernel sources installed, type
    ls /usr/src
    
    If no directory named 'linux-[YourKernelVersion]' appears, you must install the kernel sources, e.g. in RedHat/Fedora, click on System Settings > Add/Remove Applications, scroll to the 'Development' section and check the 'Kernel Development' box. Then click 'Update' to install the RPMs. In SuSE, click System > YaST. Now check that /usr/src/linux-[YourKernelVersion] is present.

  • Download the installer from the ATI website, e.g. ati-driver-installer-8.19.10-i386.run.

  • Become root

  • Check that your Linux distribution is supported:
    ./ati-driver-installer-8.19.10-i386.run --get-supported
    

Example output:

ATI/XFree86-4_1_X
ATI/XFree86-4_2_X
Debian/woody
Debian/oldstable
Debian/3.0
Debian/sarge
Debian/stable
Debian/3.1
Debian/etch
Debian/testing
Debian/sid
Debian/unstable
RedHat/RHEL3
RedHat/RHEL4
SuSE/SLES9-IA32
SuSE/SUSE91-IA32
SuSE/SUSE100-IA32
SuSE/SUSE92-IA32
SuSE/SUSE93-IA32
SuSE/SUSE101-IA32
Ubuntu/warty
Ubuntu/4.10
Ubuntu/hoary
Ubuntu/5.04
Ubuntu/breezy
Ubuntu/5.10

  • Build an RPM for your Linux distribution, taking the name from the list above, e.g. SuSE/SUSE100-IA32 for SuSE 10.0:
    
    ./ati-driver-installer-8.19.10-i386.run --buildpkg SuSE/SUSE100-IA32
    
    

  • Make sure that the X-server is not running when installing the RPM: Press <Ctrl>+<F2> to switch to a text terminal, log in as root and type
    /sbin/init 3
    

  • Install the newly built RPM, the name depends again on your choice above, e.g.:
    
    rpm -Uhv fglrx_6_8_0_SUSE100-8.19.10-1.i386.rpm
    
    

  • Check that the GCC compiler output does not say 'ERROR' (warnings are allowed).

  • Configure the ATI driver and X-server:
    fglrxconfig
    
    You will get lots of questions to answer, usually it is safe to pick the suggested default. Only when the question is "Do you want to synchronize buffer swaps with the vertical sync signal", choose "yes".

  • Reboot the machine.

  • Log in, open a console and type
    fglrxinfo
    

The output should now look similar to this one, with ATI Technologies as the OpenGL vendor:


display: :0.0  screen: 0
OpenGL vendor string: ATI Technologies Inc.
OpenGL renderer string: RADEON 9200SE DDR Generic
OpenGL version string: 1.3.1017 (X4.3.0-8.19.10)

If this worked, you are done and ready to run YASARA. Congratulations.

If you finally run YASARA, and everything looks OK, but the user interface is slow and lags behind the mouse pointer, exit the X-server and start
fglrxconfig
a second time, but now do not synchronize buffer swaps with the vertical sync signal .

Installation instructions for the old *.rpm drivers (until 2005)

You receive an RPM whose name usually looks like fglrx-[XServerVersion]-[DriverVersion].i386.rpm, e.g. fglrx-4.3.0-3.7.6.i386.rpm

ATI provides detailed installation instructions, however installation tends to fail easily.

Here are some hints:

  • Make sure to pick the ATI driver that matches your X-server. For recent Linux distributions (spring 2004), [XServerVersion] is usually 4.3.0. If you are not sure, type
    more /var/log/XFree86.0.log
    

  • Make sure that the X-server is not running when installing the RPM: Press <Ctrl>+<F2> to switch to a text terminal, log in as root and type
    /sbin/init 3
    

  • Check that you have the Linux kernel sources installed, type
    ls /usr/src
    
    If no directory named 'linux-[YourKernelVersion]' appears, you must install the kernel sources, e.g. for RedHat/Fedora, click on System Settings > Add/Remove Applications, scroll to the 'Development' section and check the 'Kernel Development' box. Then click 'Update' to install the RPMs, they usually reside on disk 3. If the installation of the kernel sources fails with an error box, do it manually:
    
    mount /mnt/cdrom
    cd /mnt/cdrom/[YourLinuxName]/RPMS
    rpm -i kernel-source-[KernelVersion etc.].rpm
    
    
    Now check that /usr/src/linux-[YourKernelVersion] is present.

If you accidentally tried to install the RPM without the kernel source present, you may have gotten this error message:

*** Error: no kernel module build environment - please consult readme.

  • Install the ATI driver RPM:
    rpm -Uh --force fglrx-[XServerVersion]-[DriverVersion].i386.rpm
    

  • Configure the ATI driver and X-server:
    fglrxconfig
    
    You will get lots of questions to answer, usually it is safe to pick the suggested default. Only when the question is "Do you want to synchronize buffer swaps with the vertical sync signal", choose "yes". There is also a question about quad-buffered stereo, but we have not had much luck with this one.

  • Restart the X-server:
    startx
    

  • Check the configuration:
    fglrxinfo
    

If the output looks about like that, you are done and can run YASARA:

display: :0.0  screen: 0
OpenGL vendor string: ATI Technologies Inc.
OpenGL renderer string: RADEON 9200SE DDR Generic
OpenGL version string: 1.3 (X4.3.0-3.7.6)

If you still see "Mesa" in the OpenGL vendor string, open the file /var/log/XFree86.0.log in a text editor and search for this message:


(EE) fglrx(0): [agp] unable to acquire AGP, error "xf86_ENOMEM"
(EE) fglrx(0): cannot init AGP
....
(WW) fglrx(0): ***********************************************
(WW) fglrx(0): * DRI initialization failed!                  *
(WW) fglrx(0): * (maybe driver kernel module missing or bad) *
(WW) fglrx(0): * 2D acceleraton available (MMIO)             *
(WW) fglrx(0): * no 3D acceleration available                *
(WW) fglrx(0): ********************************************* *

This error message indicates problems with your AGP support. Exit X and type as root
/sbin/insmod agpgart
. Restart X and try again
fglrxinfo
. If it works now, you are ready for YASARA. Note that this fix is temporary.

  • Run YASARA.

If you still have problems, make sure that you really install the latest ATI driver. The first releases were very buggy, and only with version 3.7.6 did ATI reach good quality. Version 3.7.6 works well with most Radeon cards, e.g. the 9200, 9600 series.

If YASARA finally runs, and everything looks OK, but the user interface is slow and lags behind the mouse pointer, exit the X-server and start
fglrxconfig
a second time, but now do not synchronize buffer swaps with the vertical sync signal .

° 

You are running Linux with a Xig graphics driver

Xi graphics www.xig.com distributes a commercial X-server with hardware accelerated OpenGL graphics that supports mainly ATI graphics chips up to the Radeon 9200.

Prices for these drivers with OpenGL functionality start at 69$, which is the same amount of money you would have to pay for a new GeforceFX card including drivers from nVIDIA that deliver significantly higher performance. ATI also provides faster Linux drivers.

There is mainly one situation where the Xig drivers can be very helpful: if you already own a fast ATI 9200 card and absolutely need quad-buffered stereo. Then you can buy the Xig Summit DX Platinum driver for 89$, which is much cheaper than a stereo-capable Quadro card from nVIDIA.

YASARA was tested with an ATI Radeon 9200 and the Summit_DX-Platinum driver version 2.2-16. Once some installation issued are solved, the Xig OpenGL driver runs out of the box without any visual glitches, albeit at lower speed and less smoothly than the flgrx driver from ATI.

Xig provides detailed installation instructions, nevertheless here are some hints to avoid common pitfalls:

  • Download the file Summit_DX-Platinum-[Version].tar from www.xig.com.

  • If your directory /usr/src does not contain a linux* subdirectory, install the kernel source RPMs for your Linux distribution.

  • Go to directory /usr/src and make sure that there is a symbolic link 'linux' pointing to the subdirectory that contains the kernel source. As an example, Fedora Core 1 has the kernel sources in the subdirectory 'linux-2.4.22-1.2129.nptl', so you would use this command:
    ln -s linux-2.4.22-1.2129.nptl linux
    

  • Untar the driver archive:
    tar -xvf Summit_DX-Platinum-[Version].tar
    

  • Try to remove existing Mesa drivers:
    rpm -e --nodeps Mesa
    
    This may fail.

  • Install the kernel module: e.g.
    rpm -i xsvc-3.0-50.i386.rpm
    

  • Install the OpenGL driver:
    rpm -i Summit_DX-Platinum-2.2-16.i386.rpm
    

  • Make sure you have this line in /etc/modules.conf:
    alias char-major-10-179 xsvc
    

  • Make sure the kernel driver is loaded:
    /sbin/modprobe xsvc
    

  • Configure your desktop: run
    Xsetup
    

  • Start the Xserver:
    startx
    

  • Open a terminal and type
    glxinfo
    
    If you see the following output, you are done and can start YASARA:


server glx vendor string: Xi Graphics, Inc.
server glx version string: 1.4
server glx extensions:
    GLX_ARB_get_proc_address, GLX_ARB_multisample, GLX_EXT_visual_info,
    GLX_EXT_visual_rating, GLX_EXT_import_context, GLX_SGI_make_current_read,
    GLX_SGIS_multisample, GLX_SGIX_fbconfig, GLX_SGIX_pbuffer
client glx vendor string: Xi Graphics, Inc.
client glx version string: 1.4
client glx extensions:

If it did not work, look at the various FAQ files provided by Xig in the Summit_DX-Platinum directory you untared and in /usr/src/xig.

° 

You are using a notebook

Apart from the trivial fact that notebooks often do not have sufficient OpenGL capabilities, another speed issue was reported on some notebooks with Pentium 4 processor, which react very slowly when using animated windows (blend, rotate). The reason is that many companies sell expensive 2GHz notebooks, but the processor runs permanently at 1.2GHz, even with heavy system load and a connected power supply. Nevertheless, Windows reports a CPU clock frequency of 2GHz, which leads to timing issues. To solve this problem, go to Control Panel > Power options > Power schemes and make sure that you choose a 'Desktop' setting.

° 

You have an Intel 82845G graphics chip

While YASARA normally runs nicely with this chipset, performance drops heavily as soon as you assign atom colors other than red, green, blue, cyan, magenta, yellow and gray. The driver seems to switch back to software rendering in this case. Edit the file yasara.ini and set VisualQual to 1.

° 

You have an Intel 82865G graphics chip

YASARA runs nicely on this chip unless you have an old broken driver installed. Go to Start > Control Panel > Display > Settings > Advanced > Adapter > Properties. (In WinXP, location may differ slightly in WinNT). You will see the driver date and driver version.

YASARA has been tested with driver version number 6.13.10.3510 and date 15-4-2003. If your driver is from an earlier date with a smaller version number, it contains too many bugs and you have to update it (go to www.intel.com ). At the time of writing, version 13.5.0.3691 is the latest one.

° 

You have an Intel 82915G graphics chip

YASARA runs nicely on this chip unless you have an old broken driver installed. Go to Start > Control Panel > Display > Settings > Advanced > Adapter > Properties. You will see the driver date and driver version.

YASARA has been tested with driver version number 6.14.10.3943 and date 02-11-2004. If your driver is from an earlier date with a smaller version number, it contains serious bugs like the menus turning black when you move the pointer out of the YASARA window. Please install the latest drivers from www.intel.com.

  • Drivers 6.14.10.3889 and older have a problem with the task manager. If you bring it up with <Ctrl>+<Alt>+<Del>, the OpenGL graphics may be corrupted after returning. Also if you request too much memory in yasara.ini, the driver may switch to software rendering, thus making everything unusably slow.

  • Driver 6.14.10.3943 still has a little bug that occasionally makes the mouse pointer freeze for half a second.

° 

You have an S3 graphics chip

Many of the S3 chips (e.g. ProSavage DDR) are advertised with OpenGL compatibility but use terribly slow software rendering instead. You can try to download their latest drivers from www.s3graphics.com, maybe they fixed the problems in the mean time. Do not be disappointed if you cannot run YASARA at a usable speed with these chips.

° 

You have a SiS M650 graphics chip

When using a SiS M650 graphics chip (sometimes found in cheap notebooks), it may happen that molecules are too dark and change their brightness abruptly. Debugging indicated that the SiS OpenGL driver does not display the fog properly. Click on View > Lightning > Fog and set it to 0 to disable the fog completely.

° 

You have a 3DLabs Wildcat card

Problems running YASARA were reported for a Wildcat III 6110. The problem has been reported to 3DLabs.

° 

YASARA shows strange CPU usage patterns or crashes on dual core CPUs or dual CPU systems

Windows XP up to Service Pack III has several bugs that can cause high CPU usage or even crashes when running programs like YASARA. Microsoft provides more details and a hotfix at http://support.microsoft.com/?id= 896256

° 

Something is wrong with your molecule

Molecules may be small, but they are not simple. Consequently, a lot of things can go wrong with atom names, bond orders, chemical elements etc.

° 

You used OpenBabel ('other Fileformat') to read/write the molecule

To support the millions of fileformats out there, YASARA uses OpenBabel, a library available from http://openbabel.sourceforge.net . OpenBabel has mainly one weak spot, and that's residue names and numbers. Many of the supported file formats do not even know the concept of 'residues' because they come from quantum chemistry, where one usually works with just one molecule. So after loading a structure with OpenBabel, click on various residues and check that the names and numbers are correct. Otherwise try to export the structure in PDB format before loading it in YASARA.

° 

YASARA does not behave as expected with two or more connected monitors

If you connect two or more monitors or beamers to your graphics card, there are normally two ways of making use of the extra space:

  • A single desktop covers both monitors: this approach is called 'TwinView' by nVIDIA and 'DualHead' by ATI. You can in principle resize the YASARA window to cover both monitors, as long as the window size does not exceed YASARA's maximal resolution. (In the latter case, YASARA will reduce the size again). Mac OS X may not allow you to move the YASARA window to a certain monitor and keep it there, in this case simply click Window > Fix on screen. Windows may interfere with your attempts to place the YASARA window correctly, in this case it may help to set 'CorrectWin' in yasara.ini to 0 to avoid window size corrections. If you go fullscreen, it depends on your operating system and graphics card what will happen. The YASARA window may fully cover both monitors (this can fail with nVIDIA cards in Linux, which may show you (part of) the same image on both monitors), or it may cover only one of the monitors. YASARA cannot influence on which monitor it goes fullscreen. You have to adjust this behavior yourself in the DualHead/TwinView section of your video driver.

  • Each monitor shows its own desktop: this approach is available in Linux. There is an application menu on each monitor, and programs stay on the monitor where you launched them. If you maximize the YASARA window, it will cover the monitor where it was launched. If you go fullscreen, YASARA will go fullscreen where you launched it. Since this also captures the mouse, you will not be able to move the pointer back to the other monitor unless you leave fullscreen mode.

Here are instructions on how to modify the file /etc/X11/xorg.conf to activate the mode described above on nVIDIA cards:

First, create two separate Device sections, each listing the BusID of the graphics card to be shared and listing the driver as "nvidia", and assign each a separate screen:

Section "Device"
    Identifier  "nvidia0"
    Driver      "nvidia"
    # Edit the BusID with the location of your graphics card
    BusID       "PCI:2:0:0"
    Screen      0
EndSection

Section "Device"
    Identifier  "nvidia1"
    Driver      "nvidia"
    # Edit the BusID with the location of your graphics card
    BusId       "PCI:2:0:0"
    Screen      1
EndSection

Then, create two Screen sections, each using one of the Device sections:

Section "Screen"
    Identifier  "Screen0"
    Device      "nvidia0"
    Monitor     "Monitor0"
    DefaultDepth 24
    Subsection "Display"
        Depth       24
        Modes       "1600x1200" "1024x768" "800x600" "640x480"
    EndSubsection
EndSection

Section "Screen"
    Identifier  "Screen1"
    Device      "nvidia1"
    Monitor     "Monitor1"
    DefaultDepth 24
    Subsection "Display"
        Depth       24
        Modes       "1600x1200" "1024x768" "800x600" "640x480"
    EndSubsection
EndSection

(Note: You'll also need to create a second Monitor section) Finally, update the ServerLayout section to use and position both Screen sections:

Section "ServerLayout"
    ...
    Screen         0 "Screen0"
    Screen         1 "Screen1" leftOf "Screen0"
    ...
EndSection

For further details, please refer to the XF86Config(5x) or xorg.conf(5x) manpages.

° 

Quad-buffered stereo cannot be activated or flickers.

Apart from the trivial fact that YASARA Model+ is required for true stereo support, and flat LCD/TFT screens are too slow for stereo, a few additional things can go wrong:

If you click on Window > Stereo > Quad buffered and get an error message that this video mode is not supported, then your OpenGL driver does not allow to display stereo graphics this way.

Companies like nVIDIA and ATI usually provide the real stereo option only in their expensive workstation products (nVIDIA Quadro or ATI FireGL). YASARA does currently not support workarounds with reduced resolution like interlaced or sync-doubling stereo modes. The reason is that most of the time, you can enable quad-buffered stereo by fudging your video driver, e.g. to make a Geforce believe it is a Quadro, google for: nvidia enable geforce OpenGL stereo.

  • If you use Linux, stereo can be activated on Geforce cards with drivers 3XXX to 4496 or true Quadro cards with any driver version. No matter if you own a fudged Geforce or a real Quadro, it is still required to enable stereo by adding the Option "Stereo" to the file /etc/X11/xorg.conf, like in the example below:


Section "Device"
        Identifier  "Videocard0"
        Driver      "nvidia"
        VendorName  "Videocard vendor"
        BoardName   "nVidia GeForce 2 Go"
        VideoRam    32768
        Option      "Stereo"  "1"
EndSection

  • If you use Windows and have a Quadro-like card, follow these steps:

1. Right-click on the Windows-background -> Click the properties item

2. Display Properties opens -> Click on the Settings tab -> Click on the Advanced button

3. Click on the Quadro tab -> Click on the Additional Properties... button

4. Click on the OpenGL Settings tab

5. Scroll down the Performance and Compatibility Options list

6. Enable the Enable quadbuffered stereo API list item

7. Optional: Click on the Additional OpenGL Properties... if you want to change more stereo options

8. Close all setting dialogs

After that, stereo should work.

When switching the monitor off and on again, it might be that the shutter-glasses will be out of sync. To fix this, just click on Window > Stereo > Swap

If stereo works but the image flickers , this indicates that the screen update frequency is not set high enough. As an application, YASARA can unfortunately not influence the screen update frequency all by itself, you have to do that manually:

  • If you use Linux, edit the file /etc/X11/xorg.conf. Make sure that the VertRefresh setting in the "Monitor" Section is high enough, which is however only accepted by the X-server if the HorizSync setting is also high enough. Setting HorizSync higher than your screen supports can destroy the screen, check the maximally supported KHz in the screen manual.

  • If you use Windows, follow this protocol:

1. Click Start, click Control Panel, click Appearance and Themes, and then click Display.

2. Click the Settings tab, and then click Advanced.

3. Click the Monitor tab, and then click the screen refresh rate that you want to use, at least 100 Hz for stereo.

° 

YASARA fails to run Python plugins or other programs like PovRay, OpenBabel, MSMS

Apart from the trivial reason that the program may not be installed (PovRay, MSMS), the likely explanation is that your hard disk has run full. If this is not the case, your computer may not have enough swap space left. Especially in Linux, running other programs fails silently when the swap space is exhausted. Look here for more details.

° 

YASARA or the entire computer freezes

° 

YASARA hangs, but other programs are not affected

What looks like a freeze, may actually only be a long delay caused by a lengthy calculation. YASARA normally uses progress bars to provide visual feedback, but if you are working with extremely large structures containing 100000s of atoms, even simple things can take a long time. Look here for some hints how to improve performance.

  • If you are using the Twinset, just switching to a WHAT IF menu can already take a long time (30+ seconds), especially if there are 10000s of water molecules present. Try to remove the objects containing water molecules before using WHAT IF functions.

  • If your molecule is not extremely large and you are not using WHAT IF functions, then please contact support@yasara.org, providing the scene that caused the hang.

° 

The computer freezes when you minimize the YASARA window

This problem was reported for notebooks with ATI Radeon 9600 Mobility running Windows with a Radeon driver around 6.14.10.6422. Please update your graphics driver.

° 

The computer freezes when you start YASARA a second time

This 'issue' was observed on a Dual-Athlon PC with a Geforce card and Linux. Due to a bug in NVIDIA's driver (verified for V31.23), opening two YASARA windows at the same time can freeze the PC, please download the latest driver from www.nvidia.com .

° 

YASARA quits with a red error box or crashes sometime later

The following reasons for a red error box are known inconveniences:

  • Error 2 - Essential videomode not supported: if you try to go fullscreen on an extremely high resolution screen (or two screens combined with TwinView), YASARA's resolution limits may be exceeded. More details can be found here and here.

  • Error 7 - Out of memory: algorithms in structural bioinformatics can be quite memory intensive, e.g. if they need to build a three-dimensional grid. Unfortunately operating systems still have trouble dealing with applications that request too much memory, often freezing your entire computer and causing the loss of all unsaved documents. To keep your data safe, YASARA never uses more memory than you assign via the 'Memory' setting in the file yasara.ini. The percentage of memory left is shown in the bottom left corner. If more memory is needed, YASARA will either display a simple error message or exit immediately, offering you the option to save the current scene. If raising the 'Memory' limit does not help, check if your input file accidentally contains lost atoms, that are micrometers away from the others, and delete them:
    
    DelRes LocalX<-1000 or LocalX>1000 or LocalY<-1000 or LocalY>1000 or LocalZ<-1000 or LocalZ>1000
    
    

In some very rare cases, YASARA may encounter a serious problem that makes it impossible to continue running the program. You will then see a red error box with a problem description and the option to rescue your work by saving it as a complete YASARA scene 'errorexit.sce', which you can load after restarting YASARA.

In some even rarer cases, YASARA might even crash completely without furthur notice. In either case, you will get a 10 EUR reward for reporting this problem in a reproducible way.

If you have Python installed, simply restart YASARA and click on Help > Report error.

If you do not have Python installed, do it manually by going to www.yasara.org/bugreport . For problems that are not obvious, it is usually essential to send us the last execution log. You can find these logs in the directory yasara\log with names like exec_XXXX.log, and usually the newest file is the one which contains the list of commands that lead to the crash.

Other potential causes for Windows crashes:

  • Occasional crashes were reported for a dual core machine equipped with an ATI Radeon X600 PRO card and ATI driver version 6.14.10.6542 from 2005. The Windows crash report indicated that the ATI driver module atioglxx.dll was to be blamed. Updating the Radeon driver to Catalyst 6.6 solved the problem.

  • ATI Catalyst 6.11 from 2006 with OpenGL driver 6.14.10.5819 was reported to crash on an ATI Radeon 7000 card with only 32MB video ram and two connected monitors. Closer inspection showed that the driver couldn't cope with the exhausted video ram. The problem could be solved by not expanding the desktop over both monitors.

Other potential causes for Linux crashes:

  • You run a 64bit Linux with an nVIDIA card: driver version 76.76 (see output of glxinfo) was reported to occasionally crash Linux, causing the following message in /var/log/messages: Kernel BUG at "arch/x86_64/mm/pageattr.c":154. Update to the latest driver version.

° 

The Twinset encounters a technical problem

As the Twinset consists of two programs, each with its own support infrastructure, it may not always be clear where to report problems.

  • The Twinset YASARA for Linux and Windows: Report all problems at http://www.yasara.org/bugreport, except if you typed 'WIF' to enter the WHAT IF subsystem. Then please check if your problem persists in the normal WHAT IF program, and if yes, then report it directly at http://www.cmbi.ru.nl/whatif. Some WHAT IF options require additional programs to be installed, that you probably have to download yourself and that may not be available at all for Windows. There is no bonus reward for problems traced to the WHAT IF source code.

  • The Twinset WHAT IF for Linux: Report all problems at http://www.cmbi.ru.nl/whatif except if they involve the YASARA menu or you have other reasons to believe that they are related to the Twinset and not present in the standard WHAT IF. In this case please report the problem at http://www.yasara.org/bugreport. Some WHAT IF options require additional programs to be installed, that you probably have to download yourself. We cannot provide support for those.

  • The Twinset WHAT IF for Windows: This is an experimental version without graphics, that is waiting for the completion of the WHAT IF for Windows OpenGL interface. There is currently no support for this version available.

° 

Forwarding the YASARA window via SSH does not work

This problem was reported for some combinations of RedHat and Fedora Linux. The solution: use the ssh command line parameter -Y.