Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Transform<Obj|All>

-

Transform objects


CommandArgument DatatypeDefaultMinMax
Format:Transform<Obj|All> Object selection,SELECTION ---
   KeepPos = Yes | NoSTRINGYes - -
Python: Transform<Obj|All>(selection1,keeppos=None)
Menu:Edit > Transform
Related: Center , Transfer, MoveAtom
Required:


The Transform command replaces all local atom coordinates in the selected object with the corresponding coordinates in the global coordinate system, thus fixing the current position and orientation of the object in the individual atom coordinates.

When you rotate or move an object, you change its coordinates in the global coordinate system. If you then save it (e.g. as a PDB file), the atom coordinates (in the object's local coordinate system ) remain unchanged. Sometimes however, you want the PDB file to reflect the position and orientation of the object. The Transform command takes care of that: it copies the transformed atom coordinates from the global coordinate system back to the local coordinate system.

There are two ways to ensure that this procedure does not cause an unexpected shift of the atoms on screen:

Example 1:
TransformObj 1crn,KeepPos=No

Copy the coordinates of the atoms in object 1crn with respect to YASARA's global coordinate system to the local coordinate system. To prevent the atoms from moving on screen, the object position and orientation are set to 0/0/0.


Example 2:
TransformObj 1crn,KeepPos=Yes

As above, but to make sure that the atoms do not move on screen, the object's position is subtracted from the individual atom coordinates afterwards. This way, the object position can be kept.