Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Transfer<Obj|All>

-

Transfer objects into another coordinate system


CommandArgument DatatypeDefaultMinMax
Format:Transfer<Obj|All>Source selection, SELECTION---
  Destination selection, SELECTION---
  Local = Keep | Match | FixSTRING Match--
Python: Transfer<Obj|All>(selection1,selection2,local=None)
Menu:Edit > Transfer
Related: Center , Transform, MoveAtom
Required:


The Transfer command moves and rotates the objects in the source selection to the global Position and Orientation of the destination object.

The Local parameter defines which additional transformation is applied to the atom coordinates in the local coordinate system:

  • Keep leaves all local atom coordinates as well as their transformation history untouched, the Transfer command thus simply copies the global Position and Orientation.

  • Match (the default) modifies the local atom coordinates of the source object such that they match the local coordinate system of the destination object. This is achieved by reversing the transformations done to the source object (like centering) and then applying those done to the destination object. This procedure ensures that you can load two PDB files, center them independently, move them to different global positions, and then use the Transfer command to place them on top of each other again.

  • 'Fix' modifies the local atom coordinates of the source object such that the atoms stay fixed on screen while the object's global position and orientation is changed.

If an object is transferred into the simulation cell (and 'Local' is not 'Keep'), it will receive a CRYST1 record and a transformation history that describe the cell and the object's placement inside the cell. This allows to save the simulation cell in the PDB file, disguised as the crystallographic unit cell:


# This example assumes that the scene contains a simulation cell
# and that object 1 is placed inside.
#
# Transfer the object into the cell coordinate system, without actually
# moving the atoms on screen, and add a CRYST1 record to object 1
TransferObj 1,SimCell,Local=Fix
# Save object 1 as a PDB file, including the new CRYST1 record
SavePDB 1,ProteinWithCell,Transform=Yes

The Transfer command is mainly used to solve the problem that rotating and moving an object changes its coordinates in the global coordinate system. If you then load a second object, it will appear at a different spot, requiring a transfer to fall on top of the first object.

Example 1:
TransferObj 3,5

Move object 3 on top of object 5, so that they share the same coordinate system.


Example 2:
TransferAll 1crn

Move all objects on top of object 1crn.