Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The message 'Disabled smooth atom colors' appears in the terminal

When you start YASARA under Linux and get the message
Disabled smooth atom colors because OpenGL extension XY is not supported
then your OpenGL driver is either very old or not installed properly. YASARA still runs, but it can display only the following atom colors: blue, magenta, red, yellow, green, cyan and gray, e.g. smooth color gradients will only be visible in ribbons and ray-traced output, but not in the individual atoms on screen.

This problem sometimes comes together with an error message about extension "XFree86-DRI" missing on display ":0.0" .