Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The mouse pointer disappears or flickers

This can happen if you installed a 'fancy mouse pointer'-tool, that shows very colorful pointers. If these pointers cannot be displayed as a hardware cursor by your graphics card, the operating system has to copy the mouse pointer pixel by pixel into the video ram, which often does not work with OpenGL windows. Switch back to a simple mouse pointer to solve this issue. (Under Linux, that's often an option in /etc/X11/XF86Config or /etc/X11/xorg.conf, e.g. for NVIDIA cards, you must set hwcursor to "1").