Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The message 'XFree86-DRI missing' appears in the terminal

When you start YASARA under Linux and get the message
Xlib: extension "XFree86-DRI" missing on display ":0.0"
this indicates that your OpenGL driver is not installed properly. This happens for example when installing an old nVIDIA driver on a new Linux distribution with Kernel 2.6, e.g. Fedora Core 1. Do not ignore the message, you may encounter serious graphics problems and system hangs. Instead update to the latest driver.

If you absolutely have to use an old driver (for example because of stereo support), you can still modify the old nVIDIA driver to work with a new kernel: http://www.minion.de/nvidia.html and http://sh.nu/download/nvidia/linux-2.6/