Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The 'with minimum distance from' operator finds the closest atom

This operator keeps the one single atom in the first selection that is closest to the atoms in the second selection. This is very useful in connection with chemically equivalent hydrogens (which are not numbered in YASARA).

Example:


AddSpring OE1 Res Glu 30, HH1 Res Arg 10 with minimum distance from OE1 Res Glu 30, 2.0

This command adds a spring of length 2.0 A between the OE1 atom of Glu 30 and the closer of the two HH1 atoms in the side-chain of Arg 10, thereby fixing the hydrogen bond.