Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The look of the movie depends on the aspect ratio of the YASARA window

YASARA automatically scales the scene such that movies always look the same, independent of the actual window size, as long as the aspect ratio of the view area does not change. E.g. if you create your movie with a view area of 1024x768 pixels, it will look exactly the same when played back in a view area of 640x480 pixels.

The 'view area' is the part of the YASARA window where you can see molecules. If you disable menus, then the view area is identical to the YASARA window size, otherwise it is lower by 48 pixels (the top and bottom menu bar are each 24 pixels high).

Example: You want to create a movie that will be played back on a cheap video beamer with 640x480 pixels resolution, but you do not want to make your window that small while creating the movie. In addition you still want to use the menus, but you do of course not want to show the menus with the beamer.

So the final movie resolution will be 640x480 pixels, that's an aspect ratio of 640/480 = 1.333. Now you need a window size that gives you the same aspect ratio for the view area. A typical choice for the view area is 1024x768 pixels (1024/768 = 1.333). As we also want to show the menu bars which require 48 pixels, the final window size is 1024x(768+48) = 1024x816. Press <Space> to bring up the console and type:

ScreenSize 1024,816

Now create your movie, and to play it back on the beamer, add the following commands:

ScreenSize 640,480
Menu off

Two little exceptions from these rules:

  • The head up displays are not rescaled. E.g. the location of the message created with ShowMessage depends on the window size.

  • The rules above apply only as long as the view area is <=1280x960 pixels. Above 1280x960 pixels YASARA starts to show you more of the scene and does not scale it up any more.