Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The keys and mouse buttons to use

Virtually all the keys are explained in the tutorials 'Working with YASARA', and 'Interactive Simulations for Modeling' which you can access by clicking on Help > Play help movie.

° 

Moving objects around

Shift Grab next object for movement/rotation (YASARA Model and above)
Ctrl+Shift Grab previous object for movement/rotation (YASARA Model and above)
LeftClick in the 'Name' column of the HUDGrab the selected object for movement/rotation (YASARA Model and above)
LeftButton+MouseMovement Rotate object or scene or move label
Ctrl+LeftButton+MouseMovement Rotate object or scene, centered on the marked atom
LeftButton+RightButton+MouseMovement Move object or scene along the X/Y-axes
MiddleButton+MouseMovement Move object or scene along the X/Y-axes
Cursor keys Move object or scene along the X/Y-axes
RightButton+MouseMovement Move object, scene or label along the Z-axis
1..9 Set speed of movements (not on numeric keypad)
Q,W,E,R,T,Y Move grabbed object or scene along the three axes (English keyboard)
Ctrl+1..9 Set speed of rotations (not on numeric keypad)
A,S,D,F,G,H Rotate grabbed object or scene about the three axes (English keyboard)
Z,X,C,V,B,N Start automatic rotation of grabbed object or scene about the three axes (English keyboard)
LeftClick on a label Mark label and move it around

If an object reacts strangely when moving it around , the reason is most likely that some atoms are incorrectly placed far away from the object's center, for example after reading atom coordinates from a corrupted file. This makes the object appear larger, requiring YASARA to slow down or block movements. Delete these atoms or use the keyboard instead of the mouse.

The help movie 'Working with YASARA' shows how to configure the MacBook TouchPad and the Apple MightyMouse to function optimally with YASARA. When configured as suggested, the following bindings are available:

Apple MacBook TouchPad :
Button+SingleFingerMovement Rotate object or scene or move label
Ctrl+Button+SingleFingerMovement Rotate object or scene, centered on the marked atom
DoubleFingerMovement Move object or scene along the X/Y-axes
Button+DoubleFingerMovement Move object, scene or label along the Z-axis

Apple MightyMouse:
LeftButton+MouseMovement Rotate object or scene or move label
Ctrl+LeftButton+MouseMovement Rotate object or scene, centered on the marked atom
SideButtons+MouseMovement Move object or scene along the X/Y-axes
ScrollBall Move object or scene along the X/Y-axes
RightButton+MouseMovement Move object, scene or label along the Z-axis

° 

Changing the scene style

F1 Set scene style to balls
F2 Set scene style to balls&sticks
F3 Set scene style to sticks
F4 Set scene style to Calpha trace
F5 Set scene style to tube
F6 Set scene style to ribbon
F7 Set scene style to cartoon
F8 Change side-chain style
LeftClick in the VISibility column of the HUDSwitch selected object on/off
RightClick in the same VISibility column Switch selected object on and all others off

° 

Editing

Delete Delete the marked atom or label
Alt+LeftClick on an atom Repeat the last command. KDE by default blocks this combination, use Tab instead.
Alt+LeftClick on the sequence selector Repeat the last command. KDE by default blocks this combination, use Tab instead.
Ctrl+Z or Ctrl+U Undo (YASARA Model and above)
Ctrl+R Redo (YASARA Model and above)

° 

Analyzing the soup

Insert or I Show/hide the head up display (HUD)
Ctrl+Insert or Ctrl+I Change the data displayed in the right HUD (YASARA Dynamics and above)
LeftClick on atom Mark atom, display its properties in the HUD
LeftClick on sequence selector Mark atom in clicked residue
PageDown or MouseWheelDown Mark next atom, see MouseWheel command.
PageUp or MouseWheelUp Mark previous atom, see MouseWheel command.
Ctrl+LeftClick on atoms Display distance / angle / dihedral in the left HUD (one atom must be marked)
Ctrl+LeftClick on sequence selector Zoom in on the clicked residue
RightClick on marked atom Show atom context menu
RightClick on sequence selector Show residue context menu
Home Show details about the previous charge or bond in the simulation HUD (YASARA Dynamics and above)
End Show details about the next charge or bond in the simulation HUD (YASARA Dynamics and above)
Pointer on sequence selector + lettersFind the amino acid sequence typed in one letter code while the mouse pointer is placed on top of the sequence selector

° 

Controlling a simulation

These keys only work in YASARA Dynamics and above.

F10 Change simulation temperature control
Ctrl+F10 Change simulation temperature control, reversed direction
F11 Pause/continue simulation
Ctrl+F11 Continue a paused simulation for one single step
F12 Switch simulation on/off
1..9 Set pulling force (not on numeric keypad)
Ctrl+RightButton Pull the marked atom toward the mouse pointer (during simulations)
Ctrl+LeftButton+RightButtonPull the object containing the marked atom toward the mouse pointer (during simulations)
Ctrl+MiddleButton Pull the object containing the marked atom toward the mouse pointer (during simulations)

In MacOSX, the function keys F10 to F12 are normally occupied by Expose. If you do not want to reconfigure its keybindings, you can alternatively use the three keys just below on a typical Apple keyboard: '0' instead of F10, and then the two keys to the right instead of F11 and F12 (the actual characters printed on these keys depend on your location). If you use a MacBook trackpad, you can pull the marked atom by holding down 'Command' and the trackpad button.

° 

Using the console

The console size and font can be configured separately .

Space Bring up the console
Space If pressed a second time, extend the console to full size
Return Leave the console
LeftButton Select text and copy to clipboard
MiddleButton Paste the clipboard
Ctrl+V Paste the clipboard
PageUp Scroll console one page down
PageDown Scroll console one page up
MouseWheelUp Scroll console half a page down
MouseWheelDown Scroll console half a page up
Ctrl+CursorUp Scroll console one line down
Ctrl+CursorDownScroll console one line up
CursorUp Show previous command in the history
CursorDown Show next command in the history or clear input line
Home Move cursor to start of line
End Move cursor to end of line
Ins Toggle the HUD
Ctrl+Ins Change the HUD
Esc Interrupt a running macro that does not Wait

° 

Other keys

Pause or P Pause/continue YASARA
Ctrl+Pause or Ctrl+P Continue paused YASARA for one single step
Ctrl+M Rerun the last macro or movie
Ctrl+Esc Exit YASARA immediately