Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

TimeStep

-

Set simulation time step


CommandArgument DatatypeDefaultMinMax
Format:TimeStep Inter = Multiple time step for intermolecular forces, INT2- -
   Intra = Timestep for intramolecular forces in fs FLOAT---
Python:TimeStep(inter,intra)
Menu:Simulation > Timestep
Related: SimSteps , Time
Required:


The TimeStep command sets the time step for the integration of the equations of motion during a molecular dynamics simulation.

Since intermolecular forces are more expensive to calculate, but also change more slowly over time, YASARA allows to choose two different time steps: Inter and intra for inter- and intramolecular forces respectively. Inter is not specified in femtoseconds, but in multiples of intra.

Larger time steps let the simulation proceed faster, but reduce the accuracy of the integration, which can cause the simulation to heat up and eventually 'explode'. The maximum time step that allows for a stable simulation is about 2*1.5 femtoseconds. To be on the safe side, the default simulation macros use a time step of 2*1.25 femtoseconds. Fortunately, it is easy to check that the chosen time step is appropriate:
  • If the time averaged simulation temperature displayed in the right simulation HUD converges to the value set, everything is alright.
  • If, on the other hand, the time averaged simulation temperature stays 1% or more above the requested value (e.g. 3 degrees or more at 298K), this indicates that the time step is too large for a stable simulation. YASARA will display a note in this case.
  • Finally, if the simulation explodes, YASARA will start a rescue minimization and display a warning. The default simulation macros also stop the simulation in such a case of complete failure.

Example 1:
TimeStep 2,0.8

Calculate intramolecular forces every 0.8 femtoseconds, and intermolecular forces every 2*0.8=1.6 femtoseconds.


Example 2:
TimeStep 2,1.0

Calculate intramolecular forces every femtosecond, and intermolecular forces every 2 femtoseconds (that's the choice if you have time).


Example 3:
TimeStep 2,1.5

Calculate intramolecular forces every 1.5 femtoseconds, and intermolecular forces every 3 femtoseconds (that's the fastest acceptable choice).


Example 4:
TimeStep 1,0.5

Calculate all forces every 0.5 femtoseconds.