Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Time

-

Set/get simulation time


CommandArgument DatatypeDefaultMinMax
Format:TimeFS = Current simulation time in fsFLOAT ---
Python: Time(fs)
result = Time()
Menu:Simulation > Time
Related: TimeStep
Required:


The Time command sets the current simulation time.

Setting the simulation time back to zero is helpful if a molecular dynamics simulation starts with an energy minimization and equilibration time. As soon as the data production starts, you can set the time back with 'Time 0' and save snapshots with SaveSim .

If you want to run a simulation for a certain time, use the Wait command or click 'Simulation > Continue for..'.

Example 1:
Time 0

Reset simulation time to 0.


Example 2:
Time 500000

Set simulation time to 500 picoseconds.


Example 3:
Time 2.5e6

Set simulation time to 2.5 nanoseconds.


Example 4:
Now = Time

Assign simulation time to variable 'Now'.