Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

There is a specific Python function for each experiment

In YASARA Dynamics and YASARA Structure, several experiments are available that perform complex tasks at the touch of a button. In Yanaconda, experiments expect their parameters in a separate, indented section:


# Prepare neutralization experiment
Experiment Neutralization
  # Fill the cell with water at a density of 1.0 g/cm^3
  WaterDensity 1.0
  # And NaCl counter ions with 0.9%
  NaCl 0.9
  # Protonate ionizable groups according to pH 7.0
  pH 7.0
  # Save pKa predictions as dat/1crn_mutant.pka
  pKaFile 1crn_mutant
  # Finish quickly (final water density will be OK, but not exact)
  Speed Fast
# Start experiment
Experiment On
# Wait till end of experiment
Wait ExpEnd

In Python, each experiment is wrapped by its own function instead:


ExperimentNeutralization(waterdensity=1.0,nacl=0.9,ph=7.0,pkafile="1crn_mutant",speed="fast")
Experiment("On")
Wait("ExpEnd")