Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

There is a difference between 'Hide', 'Switch off', 'Remove' and 'Delete'

Imagine there is a big lamp with some separate lights in your room, like the one below. Let's think of the lamp as a YASARA object, and of the lights as atoms.
Figure: A YASARA object consisting of three atoms, with one hidden atom on the right.

The lamp is switched on, you can see all the lights. Now hide the left light by putting a black (burn-proof) cap on top of it. You just cannot see it anymore, but it is still present. So if you hide atoms, they are invisible until you show them again, but they stay part of the object and you can still change their style. Changing their style e.g. from ball to stick does not make them visible.

If you now switch off the lamp, it is still at the original place, you just cannot see it in the darkness. So switching off an object will just make it invisible, but it is still fully present, its atoms are part of the soup.

Now take away the black cap to show the hidden light again - you still cannot see it, until you switch on the entire lamp. So if you show an atom in an object that is switched off, you will not see it unless you also switch on the object.

If you remove the lamp, it still exists somewhere (wherever you put it in the next room), but toggling the switch will give no result. So a removed object is not part of the soup anymore, it is stored somewhere else to be reused again later. There is no way you can do anything with a removed object, unless you bring it back.

Take a hammer and smash the entire lamp. Now its existence has been 'Deleted', it is lost forever. Your last remaining option is to turn back time (by pressing the Undo button provided by YASARA Model and above).