Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

There is a Python function wrapper for most YASARA commands

The syntax of YASARA commands is optimized for a minimum number of key-strokes, which conflicts with Python's own syntax. The YASARA Python module therefore contains Python function wrappers for most YASARA commands.

Example: The YASARA command to choose a new font..

Font Arial,Height=2,Spacing=1.5,Color=Yellow,Depth=5,DepthCol=Red

..has the following equivalent in the Python module:

Font("Arial",height=2,spacing=1.5,color="Yellow",depth=5,depthcol="Red")

The documentation page of each YASARA command lists the prototype of the corresponding Python function, e.g. the Font command (look at the 'Python:' row in the table at the top of each page).