Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The header identifies a plugin

The first line of a YASARA Python plugin must always read '# YASARA PLUGIN'. Adapt the remaining fields to describe your plugin. This information will be used if you decide to add it to the YASARA plugin repository at www.yasara.org/plugins in return for YASARA thank-you credits. Go to www.yasara.org/contribute to submit your plugin.


# YASARA PLUGIN
# TOPIC:       Database interfaces
# TITLE:       Retrieve a PDB file by FTP
# AUTHOR:      Elmar Krieger
# LICENSE:     GPL (www.gnu.org)
# DESCRIPTION: This plugin asks for a PDB ID and retrieves the file by FTP
#