Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

TextInputMenu[1-4]

-

Add a menu allowing to input 1 to 4 text strings

This keyword adds a window with one to four text input boxes. In addition to the window header, you must specify a general explanation for the user and then one header for each text input box.

The content of the jth text input box in the ith selection window can be accessed by the Python plugin as yasara.selection[i].text[j] (see below).

Example for a window with two text input boxes:

MainMenu: Options
  PullDownMenu: _R_eport error
    TextInputMenu2: Send an error report by e-mail
      Text: Please give a brief description of the problem:
      Text: _D_escription part 1 (header for the first input box)
      Text: _D_escription part 2 (header for the second input box)