Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

TempCtrl

-

Set temperature control


CommandArgument DatatypeDefaultMinMax
Format:TempCtrl Type = Off | Rescale | Reassign | SteepDes | Anneal STRING-- -
Python:TempCtrl(Type)
Menu:Simulation > Temperature control
Keys:<F10>  -  Choose next temperature control method, click here for MacOSX alternatives.
<Ctrl>+<F10>  -  Choose previous temperature control method, click here for MacOSX alternatives.
Related:Temp, AnnealSteps , MinStep, PressureCtrl
Required:


The TempCtrl command sets the temperature control method used to either keep the simulation at the target temperature or freeze it during an energy minimization.

Temperature control is required since the small numerical integration errors due to the finite time step accumulate and cause an increase in simulation temperature.

  • TempCtrl Rescale keeps the time averaged temperature at the requested value by rescaling the atom velocities. To minimize the influence of rescaling, YASARA does not use the fluctuating instantaneous temperature to change velocities at each simulation step. Instead the time average temperature is calculated, then the atom velocities are rescaled about every 25 simulation steps. In case you want even less rescaling, the Temp command shows how to create a custom protocol.

  • TempCtrl Reassign simply reassigns random velocities, corresponding to a random collision of every atom. This has a larger influence on the system than rescaling and should therefore be avoided in standard simulations.
  • TempCtrl SteepDes and TempCtrl Anneal activate steepest descent and simulated annealing energy minimizations.

Example 1:
TempCtrl Off

Do not control the temperature in the simulation cell.


Example 2:
TempCtrl Rescale

Slowly rescale atom velocities to reach the target temperature.


Example 3:
TempCtrl Reassign

Reassign atom velocities in random intervals to reach the target temperature.


Example 4:
TempCtrl SteepDes

Keep atom velocities at zero and perform a steepest descent minimization.


Example 5:
TempCtrl Anneal

Scale atom velocities down by 0.9 every AnnealSteps simulation steps, slowly cooling the system to 0K.