Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Temp

-

Set/get simulation temperature


CommandArgumentDatatypeDefault Min Max
Format: Temp degrees = Simulation temperature in degrees Celsius or Kelvin,TEMPERATURE ---
  Reassign = Yes | NoSTRINGYes- -
Python:Temp(degrees,reassign)
result = Temp()
Menu:Simulation > Temperature
Related:TempCtrl, AnnealSteps , MinStep
Required:


The Temp command sets the new target temperature to be reached during a molecular dynamics simulation, which is also displayed in the simulation HUD on the right side two lines below the current 'Temperature'.

If the Temp command is given during a simulation, YASARA will additionally reassign all atom velocities to match the specified temperature using a Maxwell-Boltzmann distribution, unless the Reassign parameter is set to 'no'. Note that this reassignment is unlikely to result in exactly the requested temperature, since there is a permanent interconversion between kinetic energy (temperature) and potential energy (force field energy).

In addition to setting a target temperature, you therefore have to set the temperature control to 'rescale', so that YASARA slowly rescales the atom velocities until the desired temperature is reached.

If YASARA's rescaling is still too fast, you can create your own protocol:


# Very slowly heat the system from 0 to 500K in 60 picoseconds
Temp 0
TempCtrl Rescale
TimeStep 2,1.0
# Total simulation time for heating: 500*60*2*1.0 = 60000 fs
for i=1 to 500
  Temp (i),reassign=No
  Wait 60

An additional function of the Temp command is to serve as a random number seed: If you want to check how much the outcome of a simulation depends on the random number generator used to assign the initial atom velocities, just run the simulation a second time at a slightly different temperature, e.g. +-0.01 degrees.

Example 1:
Temp 25C

Set simulation temperature to 25 degrees Celsius and reassign atom velocities.


Example 2:
Temp 298K,Reassign=No

Set simulation temperature to 298 Kelvin, but do not change current atom velocities.


Example 3:
t = Temp

Assign current simulation temperature (in Kelvin) to variable 't'.