Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The 'with distance <>X from' operator measures distances between atoms

If you want to select items close to or far away from something (e.g. a ligand), this is the operator of choice. It keeps everything in the first selection that has the right distance X from the items in the second selection.

Examples:
ColorAtom CA with distance < 10 from Mol C,yellow
Color all CA atoms that are closer than 10 A to molecule C yellow
ColorRes Asp Glu with distance < 5 from Arg Lys,blue
Color all Asp or Glu residues blue, that have at least one atom closer than 5 A to an Arg or Lys residue
ListRes all with distance > 8 from ATP
List all residues that do not contain any atom closer than 8 A to an ATP residue
DelRes HOH Atom O with distance > 6 from Protein
Delete all water molecules whose oxygen atom is more than 6 A away from any protein