Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The 'with distance <>X from Y surface...' operator measures distances from a surface

Selecting atoms based on the distance from a surface is a convenient way of identifying for example those that are in the protein core. The calculation of accessible surface areas does not always give an optimal answer, because even residues pointing to the surface are often completely buried (e.g. a surface Alanine covered by the side-chain of another surface Arginine).

This operator keeps everything in the first selection that has the right distance X from the VdW, molecular or accessible surface(s) defined by the second selection. There are two alternative ways of defining the surface(s):

  • 'with distance <>X from Y surface of' builds the surface(s) for the atoms in the second selection considering the current surface environment.

  • 'with distance <>X from Y surface touched by' builds the surface(s) for the entire object and keeps only those surface(s) that have a contribution from one or more atoms in the second selection. Most proteins have more than one surface (the main surface plus some cavities), and this operator allows to pick one of these surfaces. More details can be found at the FirstSurfAtom command.

Periodic boundaries are ignored when calculating surface distances.

Examples:
ShowAtom all with distance < 5 from molecular surface of Obj 1
Show all atoms that are closer than 5 A to the molecular surface of object 1
ListRes Lys Arg Glu Asp with distance > 8 from accessible surface of all
List all charged residues that do not have any accessible surface closer than 8 A (FirstSurfAtom is required to also find those facing cavities)
CountAtom Element C with distance < 6 from VdW surface touched by 3456
Count the carbon atoms that are closer than 6 A from the Van der Waals surface touched by atom 3456