Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The 'with contribution to X surface...' operator analyzes surface contributions

While every atom has a distance from a given surface , only a specific set of atoms actually contribute to this surface: those atoms with the shortest distance from a given point on the surface.

This operator keeps everything in the first selection that is also in the second selection and has the shortest distance from at least one point on the VdW, molecular or accessible surface(s) defined by the second selection. Again, there are two alternative ways of defining the surface(s):

  • 'with contribution to X surface of' builds the surface(s) for the atoms in the second selection considering the current surface environment.

  • 'with contribution to X surface touched by' builds the surface(s) for the entire object and keeps only those surface(s) that have a contribution from one or more atoms in the second selection. Most proteins have more than one surface (the main surface plus some cavities), and this operator allows to pick one of these surfaces. More details can be found at the FirstSurfAtom command.

To select the buried residues instead of the exposed ones, the operator can be inverted by using 'without contribution'.

Periodic boundaries are ignored when analyzing surface contributions.

Examples:
ListRes Lys with contribution to molecular surface of Obj 1
List all Lysines that contribute to the molecular surface(s) in object 1
CountAtom all with contribution to accessible surface touched by 3478
Count the number of atoms contributing to the same accessible surface(s) as atom 3478
ShowRes all with distance>12 from Lys 310 with contribution to accessible surface of protein
Show all residues that are more than 12 A away from Lys 310 and contribute to the accessible surface of the protein
ColorRes all without contribution to molecular surface touched by 1,yellow
Color all residues yellow that do not contribute to the molecular surface touched by residue 1