Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The console needs to be switched off for maximum performance

By default, the Python module runs YASARA in interactive graphical mode. This means that the YASARA window is permanently updated (at least after each YASARA Python function you call), and that you can even work with YASARA interactively while your Python script is doing something else.

If your Python script needs to call thousands of YASARA functions in a loop, this approach soon becomes too slow. The solution is the same as used by Yanaconda macros and Python plugins , switching off the console:


Console("Off")

Your Python script is then responsible for updating the screen by calling the Wait() function.