Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The command line parameters

You can get a list of all supported command line parameters by running YASARA with the -help option.

-con Run YASARA in interactive console mode
-txt Run YASARA in plain text mode
-upd Update simulation parameters, recompile the force fields
Filename.??? Load and display the specified PDB file
Filename.log Record all console output to Filename.log
Filename.mcr Var=XExecute the specified macro , optionally setting 'Var' to X.
Filename.sce Load and display the specified SCE file
Filename.yob Load and display the specified YOB file
Filename.py Req Execute the specified Python plugin with request 'Req'
-norun Tell the installer not to run YASARA directly

When you specify a macro to run as 'Filename.mcr' it is sometimes helpful to set certain variables, like the MacroTarget. The following example sets variables 'a' to 5 and 'MacroTarget' to '/home/work/1crn.pdb':

yasara MyMacro.mcr a=5 "MacroTarget='/home/work/1crn.pdb'"
or
Yasara.exe MyMacro.mcr a=5 "MacroTarget='/home/work/1crn.pdb'"

Note the double quotes around the last parameter, they prevent the operating system from removing the single quotes before passing the parameter to YASARA.

In case you are working with Windows and have not used command line parameters before, there are two ways of passing these parameters to a program:

  • Create a shortcut to yasara.exe, right-click on the shortcut, and select properties. Search for the 'Target input box' containing the path to yasara.exe, e.g. "C:\Program Files\yasara\yasara.exe". Then type the command line parameters right after this path (outside the quotes).

  • Open an MSDOS command prompt, CD to the yasara directory and type 'yasara' followed by the command line parameters, e.g.
    yasara -upd