Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The 'with <>X bonds to' operator analyzes bound atoms

This operator keeps those atoms in the first selection that make the specified number of bonds to atoms in the second selection.

Examples:
ShowAtom Element H with bond to Element !C
Show all polar hydrogens
HideAtom Element H with 1 bond to Element C
Hide all non-polar hydrogens
ColorAtom Element N with >2 bonds to Element H,red 
Color N-terminal and Lysine nitrogens red
DelAtom all with <4 bonds to all
Delete all atoms making less than four bonds

Note that bonds to metal ions are normally visualized as arrow cylinders, but not treated as real bonds and thus ignored by this operator.