Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The 'with <>X bond angles to' operator analyzes second neighbor atoms

This operator keeps those atoms in the first selection that make the specified number of bond angles to atoms in the second selection.

Examples: 
ShowAtom Element H with bond angle to Element H
Show hydrogens that have chemically equivalent partners bound to the same heavy atom 
ShowAtom Element H with bond to Element C and with 1 bond angle to Element H
Show methylene hydrogens
ShowAtom Element H with bond to Element N and with 2 bond angles to Element H
Show hydrogens in positively charged amino groups and ammonia.

Note that bonds to metal ions are normally visualized as arrow cylinders, but not treated as real bonds and thus ignored by this operator.