Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The 'and', 'or' and 'not' operators perform logical operations

At some occasions, the implicit logical ANDs and ORs are not sufficient to express your selection. You can then also use them explicitly and add a 'not' to negate the entire selection block.

Examples:
ColorAtom !CA !CB,Blue
Color all blue (atoms which are not CA or not CB, which adds up to everything)
ColorAtom !CA and !CB,Blue
Color all except CA and CB atoms blue (solving the problem above)
ColorAtom not CA CB,Blue
Same as above. Take atoms called CA or CB and invert the selection.
DelAtom CA Res Lys or CB Res Arg
Delete CA atoms in Lys plus CB atoms in Arg (note that after the 'or', the selection type has been switched back to 'Atom' even though it was at 'Res' before the 'or')
DelAtom Protein and not CA Res Lys
Delete all protein atoms except CA in Lys

Note that the explicit 'and' (in contrast to the explicit 'or') performs an inflation before the actual operation:

ColorAtom CA and CB,Blue
Color nothing at all (no atom is called CA and CB at the same time)
ColorRes Atom CA and Atom CB,Blue
Color all residues with a CA and a CB atom blue

The same is true for the 'not'. It also inflates the current selection block before inverting:

DelRes Atom CA
Delete all residues that contain a Calpha atom
DelRes Atom !CA
Delete all residues that contain an atom which is not a Calpha (leave the Calpha only residues)
DelRes not Atom CA
Delete all residues that do not contain a Calpha atom (note how the selection of Calpha atoms has been inflated to cover entire residues before being inverted by the 'not')
DelMol not Res Lys
Delete all molecules that do not contain a Lys residue
DelMol not Res Lys Arg
Delete all molecules that contain neither a Lys nor an Arg residue
DelMol not Res Lys or not Res Arg
Delete all molecules that do not contain a Lys or do not contain an Arg residue
ShowAtom Res Lys 43 Mol A or Res Arg 55 Mol B and SideChain CA
Show side-chain plus CA atoms in residues Lys 43 (molecule A) and Arg 55 (molecule B)