Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The 'min', 'max', 'sum', 'mean', 'stddev' and 'join' functions return the smallest, largest, sum, mean, standard deviation and concatenation of all list elements

These five functions scan all variable names that match the given root name and return the smallest, largest, summed up and average value, respectively. The datatype of the result is either an integer or float, depending on the list elements. The standard deviation is calculated using the formula:

StdDev^2 = Sum((ElementX-Mean)^2) / Elements

Example for a simple list:

MyList() = 1,4,-5,10,8,2
Print (count MyList)
Print (min MyList)
Print (max MyList)
Print (sum MyList)
Print (mean MyList)
Print (stddev MyList)
Print (join MyList)

6
-5
10
20
3.33333333333333e+00
4.88762609953839e+00
1 4 -5 10 8 2