Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The 'with <>X atoms closer Y among' operator counts close atoms

For every atom in the first selection, this operator counts the number of atoms in the second selection that are closer than Y Angstroms, compares it with X and keeps the atom if the result is true.

Examples:
DelRes HOH with < 5 atoms closer 4.5 among Protein
Delete all waters with less than 5 protein atoms closer than 4.5 Angstroms
DelRes Atom CA with 2 atoms closer 4 among Atom CA
Delete all residues whose CA atoms have 2 other CA atoms within 4 Angstroms