Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Tabulate

-

Add cells to table


CommandArgument DatatypeDefaultMinMax
Format:Tabulate Number = Number to add FLOAT- - -
Python: resultlist = Tabulate(number)
Menu:Options > Table > Add
Related:Tab, SelectTab , MakeTab, ShowTab , LoadTab, SaveTab , DelTab, FlipTab
Required:


The Tabulate command adds numbers as new cells to the currently selected table .

There are three ways of using Tabulate
  • By specifying an arbitrary number of values to add directly
  • By specifying nothing at all, in this case the return values of the following command will be added to the table.
  • By specifying a complete command, this will also add the return values of the command to the table.

If no table has been made before , the Tabulate command creates a new one-dimensional table with name 'Default' and usually the table number 1.

Cells can only be added to growing tables, not to those created with a fixed size.

When all the data have been collected, the table can be shown or saved to disk and imported into any spreadsheet program.

Tables currently only support numerical values, character strings (e.g. residue names) are not allowed. If a command returns strings, they will not be added to the table.

Example 1:
Tabulate 1.5

Add 1.5 to the currently selected table .


Example 2:
Tabulate 1.5,6,-7

Add 1.5, 6 and -7 to the currently selected table .


Example 3:
Tabulate

Add return values of next command to the currently selected table .


Example 4:
Tabulate RMSDAtom CA Obj 1,CA Obj 2

Add CA RMSD between objects 1 and 2 to table.