Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Tab

-

Set/get table cells


CommandArgument DatatypeDefaultMinMax
Format:TabTable selection, SELECTION---
  Column = Table column, INTAll--
  Row = Table row, INTAll--
  Page = Table page, INTAll--
  Set = New table cell value, FLOAT---
  NumFormat = Number formatSTRING - --
Python:Tab(selection1,column,row,page,set,numformat)
resultlist = Tab(selection1)
Menu:Options > Table > Set/get cells
Related:Tabulate, SelectTab , MakeTab, ShowTab , DelTab, LoadTab , SaveTab, FlipTab
Required:


The Tab command provides access to tables on the cell level. If one of the column, row or page parameters is left out, all colums, rows or pages are addressed at the same time.

The NumFormat parameter is explained at the SaveTab command.

Example 1:
Tab 2

List the content of table 2.


Example 2:
Tab 3,NumFormat=.0f

List the content of table 3 rounded to integer numbers.


Example 3:
Tab 5,Set=0

Set all cells in table 5 to zero.


Example 4:
Tab Default,Column=6,Set=10

Set all cells in column 6 of the table named 'Default' to 10.


Example 5:
cell = Tab 6,9,7,4

Assign the content of cell 9/7/4 in table 6 to variable 'cell'.


Example 6:
row() = Tab 1,Row=5,Page=2

Assign the contents of the cells in row 5 on page 2 of table 1 to the list 'row'.


Example 7:
Tabulate Tab 3

Append table 3 to the table currently selected .