Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The Twinset encounters a technical problem

As the Twinset consists of two programs, each with its own support infrastructure, it may not always be clear where to report problems.

  • The Twinset YASARA for Linux and Windows: Report all problems at http://www.yasara.org/bugreport, except if you typed 'WIF' to enter the WHAT IF subsystem. Then please check if your problem persists in the normal WHAT IF program, and if yes, then report it directly at http://www.cmbi.ru.nl/whatif. Some WHAT IF options require additional programs to be installed, that you probably have to download yourself and that may not be available at all for Windows. There is no bonus reward for problems traced to the WHAT IF source code.

  • The Twinset WHAT IF for Linux: Report all problems at http://www.cmbi.ru.nl/whatif except if they involve the YASARA menu or you have other reasons to believe that they are related to the Twinset and not present in the standard WHAT IF. In this case please report the problem at http://www.yasara.org/bugreport. Some WHAT IF options require additional programs to be installed, that you probably have to download yourself. We cannot provide support for those.

  • The Twinset WHAT IF for Windows: This is an experimental version without graphics, that is waiting for the completion of the WHAT IF for Windows OpenGL interface. There is currently no support for this version available.