Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

The Spaceball 3D controller does not work as expected

The Spaceball from 3DConnexion is currently only supported in Linux. YASARA has been tested with the Spaceball 3003FLX, but also the later models should be compatible.

Before you start YASARA, make sure that the Spaceball driver is running:

ps -ef | grep xdriver

If you do not see output except one line with grep, start the xdriver manually (you can find the program on the Spaceball CD in the unix/linux directory).

./xdriver -new

Click 'Automatic search' to locate the Spaceball. If it cannot be found, follow the hints displayed and also run the xdriver program as root.

As soon as the Spaceball has been detected, choose the Application 'X Window Driver 2.0/3.0' and click 'Install', then 'Exit'.

Now you can start YASARA and configure your Spaceball by clicking on Window > Spaceball. More details can be found at the SpaceballPar and SpaceballButton commands.