Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Switch<Obj|All>

-

Switch objects on/off


CommandArgument DatatypeDefaultMinMax
Format:Switch<Obj|All> Selection, SELECTION- - -
   Visibility = On | OffSTRING - --
Python:Switch<Obj|All>(selection1,visibility)
Menu:View > Switch object
Related: Show , Hide
Required:


Contrary to the Show and Hide commands that act on atoms, Switch works on entire objects and can thus also be applied to objects without atoms (like the simulation cell).

You can also click in the VISiblity column of the top right Object Properties HUD to switch objects on or off.

Example 1:
SwitchObj 1crn,off

Switch object 1crn off completely, including secondary structure and surfaces.

Example 2:
SwitchObj SimCell,off

Switch the simulation cell off.