Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SwitchBoxMenu[1-5]

-

Add a menu allowing to switch between 1 to 5 options

This keyword adds a window with one to five switch boxes, where exactly one box can be selected. This allows to choose between up to five exclusive options, you must specify a general explanation for the user and then one additional text for every switch box.

The number of the hooked box in the ith selection menu can be accessed by the Python plugin as yasara.selection[i].switchbox (see below).

Example for a menu with two switch boxes:

MainMenu: Options
  PullDownMenu: _R_eport error
    SwitchBoxMenu2: Concretize the error
      Text: Did the problem occur right now?
      Text: _Y_es, I did not exit YASARA since then.
      Text: _N_o, just before, I had to restart YASARA to get here.