Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Selection windows allow to build selections with the mouse

Whenever you use the graphical interface, you bump into mouse-driven selections. They usually start with a little pop-up menu asking whether you want to select All, Objects, Molecules, Residues or Atoms. Here you pick your final selection type . If you choose all, no further selection is required, otherwise a window specific for your final selection type will appear.

Remember that your selection will be inflated to the final type , so if you chose to select residues, you never get less (e.g. a side-chain).

Here is an example for the atom selection window:
Figure: The atom selection window

The list on the left allows you to select atoms sequentially. They are listed in order of increasing numbers. For every atom, the list shows its name, and the residue, molecule and object the atom belongs to. Selecting multiple atoms works as usually: Press <Ctrl>+<LeftButton> to (un)select more than one and <Shift>+<LeftButton> to (un)select a range of atoms.

The list in the middle allows to select atoms by name. In this example, we picked 'CA'. Because the 'Negate' box below the list is checked, we select all except CA atoms.

The list on the right contains various properties to choose from. Here 'SecStr Helix' has been activated.

At the bottom, there is the 'Manual selection' box, where you can extend your selection manually. Whatever you type there is connected with a logical AND to your selection. (Unless you check the 'Or' button in the bottom left corner, then a logical OR is used).

All together, this selection now reads:

!CA SecStr Helix and Res 100-200

And, as explained in the previous sections, this expression selects all atoms that are not Calphas, sit in a helix and belong to residues in the range 100 to 200.

Another example: To show all residues closer than 5 A around a ligand , you would click View > Show > Residue, select 'All' in the rightmost list and type the following in the manual selection box at the bottom: 'with distance<5 from Hetgroup'. See the help movie 'Molecular graphics' for more details.

If you are unsure how the things you pick are translated to a selection expression, just try it, press OK, bring up the console with <SPACE> and see which expression YASARA created from your selection.