Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SwapRes

-

Swap residue side-chains


CommandArgument DatatypeDefaultMinMax
Format:SwapResResidue selection, SELECTION---
  new = New residue name STRING---
Python:SwapRes(selection1,new)
Menu:Edit > Swap > Residue
Related: SwapObj , SwapAtom, SwapPosAtom
Required:


The SwapRes command changes the residue side-chain, trying to preserve the current rotamer. It does not do a search through rotamer space to find the best side-chain conformation.

A number of special residue names are supported to choose among different protonation states:

NameDetails
ASH Aspartic acid with neutral side-chain
CYM Cysteine without HG atom and negatively charged side-chain
CYX Bridge cysteine without HG atom and neutral side-chain
GLH Glutamic acid with neutral side-chain
HID Neutral histidine with hydrogen on the ND1 atom
HIE Neutral histidine with hydrogen on the NE2 atom
HIP Positively charged histidine

Hydrogens will be added to the new side-chain only if the object already contains hydrogens.

When swapping DNA/RNA bases, note that YASARA does not modify the backbone. So if you switch adenosine to uridine, YASARA will not add an oxygen to the C2* atom to account for the fact that Uridine appears only in RNA. Instead, you have to add the C2* hydroxyl group yourself by swapping the H2* hydrogen to oxygen .

Swapping single nucleotides that are not part of a DNA/RNA strand (ATP, GDP etc.) is also possible, see the example below.

The following macro gives an example for judging the quality of mutants created with SwapRes:


# Example for point mutation analysis.
# This is a qualitative approximation, true free energy calculations
# will be supported in YASARA Structure.
Clear
# Set the wild type residue (wtres) to mutate
proteinname='5tim'
wtres='Arg 207 Mol A'
# The mutants, wt must appear again as the first one
mutlist='Arg','Lys','Glu','Ala','Val','Asn','Tyr','Phe','Trp'
# Set the force field parameters
ForceField Amber99
Cutoff 7.86
Longrange Coulomb
Boundary Periodic
# Try all mutations
for i=1 to count mutlist
  mutres=mutlist(i)
  ShowMessage 'Analyzing mutation (wtres) -> (mutres)'
  # First calculate the solvation energy of the amino acid in the unfolded state,
  # so that we can detect the energetic cost of burying a polar/charged residue
  Clear
  BuildRes (mutres)
  AddCap ACE+NME
  Clean
  Cell Auto,Extension=10
  # Ignore the net charge
  Sim Init
  Charge 0
  unfoldedsolvenergy(i) = SolvEnergy
  Wait 30
  # Load the protein
  Clear
  LoadPDB (proteinname)
  Style Ribbon,BallStick
  DelRes Hetgroup
  Clean
  ZoomAtom CA Res (wtres)
  # Fix everything not close by
  FixAtom all with distance>6 from Res (wtres)
  # Make the mutation
  SwapRes (wtres),(mutres)
  # Energy minimize the environment of the residue
  Experiment Minimization
  Experiment On
  Wait ExpEnd
  # Save the scene for later manual inspection
  SaveSce (proteinname)_(wtres)_(mutres)
  # Calculate potential and solvation energy
  Charge 0
  potenergy(i) = Energy
  foldedsolvenergy(i) = SolvEnergy
# Print the results
Console Off
print 'Results of the simple mutation analysis, negative values are better than the wildtype:'
print '[This is a qualitative estimate, quantitative free energies will be supported in YASARA Structure]'
for i=1 to count mutlist
  print 'Mutation (wtres) -> (mutlist(i)):'
  print '  Potential energy = (0.00+potenergy(i)), Solvation energy = (0.00+foldedsolvenergy(i)) [folded] and (0.00+unfoldedsolvenergy(i)) [unfolded] (EnergyUnit)'
  print '  Total energy difference to wildtype = (0.00+(potenergy(i)+foldedsolvenergy(i)-unfoldedsolvenergy(i))-(potenergy(1)+foldedsolvenergy(1)-unfoldedsolvenergy(1))) (EnergyUnit)'
Console On


Example 1:
SwapRes Lys 15,Ile

Mutate lysine 15 to isoleucine.


Example 2:
SwapRes Ala,Trp

Mutate all alanines to tryptophanes.


Example 3:
SwapRes A 6,T

Mutate adenosine 5 to thymine.


Example 4:
SwapRes GDP,A

Mutate all GDP residues to ADP.


Example 5:
SwapRes Obj 5,Ala

Make object 5 an alanine-only structure.



Example macro:

# EXAMPLE SwapRes
Clear
LoadPDB 1crn
Style Stick
SwapRes All,Trp

Figure: Result of the example macro above.