Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SwapPosAtom

-

Swap atom positions


CommandArgument DatatypeDefaultMinMax
Format:SwapPosAtom Atom selection 1, SELECTION- - -
   Atom selection 2SELECTION---
Python:SwapPosAtom(selection1,selection2)
Menu:Edit > Swap > Atom positions
Related:SwapObj, SwapRes , SwapAtom
Required:


Example 1:
SwapPosAtom 300,315

Let atoms 300 and 315 change place.


Example 2:
SwapPosAtom CA Res 10-20, HA Res 10-20

Turn residues 10-20 into D-amino acids.



Example macro:

# EXAMPLE SwapPosAtom
Clear
LoadPDB 1crn
for i=1 to 23
  SwapPosAtom CA Res (i),CA Res (47-i)
Style BallStick

Figure: Result of the example macro above.