Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SwapObj

-

Swap two objects in the list


CommandArgumentDatatypeDefault Min Max
Format: SwapObj Object selection 1,SELECTION ---
   Object selection 2SELECTION ---
Python: SwapObj(selection1,selection2)
Menu:Edit > Swap > Objects
Related: SwapRes , SwapAtom, SwapPosAtom , DelObj, RemoveObj
Required:


When objects swap place in the list of objects, their atom numbers change. Atom numbering starts with 1 at the first active objects and proceeds down the list (shown in the top right head-up display).

Example:
SwapObj 1,5

Let objects 1 and 5 swap place in the list of objects.