Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SwapHyd<Obj|All>

-

Swap hydrogen ordering in residues


CommandArgumentDatatypeDefault Min Max
Format: SwapHyd<Obj|All> Object selection,SELECTION ---
   Order = mixed | separatedSTRING-- -
Python:SwapHyd<Obj|All>(selection1,order)
Menu:Edit > Swap > Hydrogens
Related:AddHyd , DelHyd, Clean
Required:


The current PDB standard is to collect the hydrogens at the end of residues, while it is often more convenient (and required by some NMR programs) to order them immediately after the heavy atom they belong to.

Example 1:
SwapHydObj 1crn,Order=mixed

Mix the hydrogens with the heavy atoms in object 1crn, making sure that hydrogens immediately follow their heavy atoms in the soup.


Example 2:
SwapHydObj 1crn,Order=separated

Separate the hydrogens from the heavy atoms in object 1crn, collecting them at the end of residues.