Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SwapBond

-

Swap order of covalent bonds


CommandArgumentDatatypeDefault Min Max
Format: SwapBond Atom selection 1,SELECTION ---
   Atom selection 2,SELECTION ---
   Order = Bond order,FLOAT 1.01.03.0
   update = Yes | NoSTRINGYes - -
Python: SwapBond(selection1,selection2,order=None,update=None)
Menu:Edit > Swap > Bond
Related: AddBond , DelBond, TypeBond , pH, AddSpring
Required:


The SwapBond command changes the order of covalent bonds between selected atoms. The same action is performed by the AddBond command if two already bound atoms are selected.

The easiest way to swap a bond manually is by marking two atoms like when measuring a distance, and then clicking 'Swap > Bond' in the atom context menu of the atom marked with white fireflies.

Many more details, especially about bond orders, can be found at the AddBond command and here .

If the selected object contains hydrogen atoms, the SwapBond command will automatically update all hydrogens to match the new bond order, unless the update flag is set to 'no'. E.g. if you have an ethane molecule and swap the single bond to a double bond, the six sp3 hydrogens will be replaced by four sp2 hydrogens, resulting in ethene.

Example 1:
SwapBond 105,109,1.5

Swap the order of the bond between atoms 105 and 109 to 1.5.


Example 2:
SwapBond all,all,1

Swap all bond orders to single bonds.